ID: 1079750690

View in Genome Browser
Species Human (GRCh38)
Location 11:24192352-24192374
Sequence ATGATGATTACTACAGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079750689_1079750690 -10 Left 1079750689 11:24192339-24192361 CCTCTCATGACACATGATGATTA No data
Right 1079750690 11:24192352-24192374 ATGATGATTACTACAGTTCAAGG No data
1079750688_1079750690 -9 Left 1079750688 11:24192338-24192360 CCCTCTCATGACACATGATGATT No data
Right 1079750690 11:24192352-24192374 ATGATGATTACTACAGTTCAAGG No data
1079750685_1079750690 4 Left 1079750685 11:24192325-24192347 CCTCCCACGGAGTCCCTCTCATG No data
Right 1079750690 11:24192352-24192374 ATGATGATTACTACAGTTCAAGG No data
1079750682_1079750690 24 Left 1079750682 11:24192305-24192327 CCTTCCTCATGATTAAATTACCT No data
Right 1079750690 11:24192352-24192374 ATGATGATTACTACAGTTCAAGG No data
1079750687_1079750690 0 Left 1079750687 11:24192329-24192351 CCACGGAGTCCCTCTCATGACAC No data
Right 1079750690 11:24192352-24192374 ATGATGATTACTACAGTTCAAGG No data
1079750686_1079750690 1 Left 1079750686 11:24192328-24192350 CCCACGGAGTCCCTCTCATGACA No data
Right 1079750690 11:24192352-24192374 ATGATGATTACTACAGTTCAAGG No data
1079750683_1079750690 20 Left 1079750683 11:24192309-24192331 CCTCATGATTAAATTACCTCCCA 0: 179
1: 3380
2: 6600
3: 9708
4: 11553
Right 1079750690 11:24192352-24192374 ATGATGATTACTACAGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079750690 Original CRISPR ATGATGATTACTACAGTTCA AGG Intergenic
No off target data available for this crispr