ID: 1079750691

View in Genome Browser
Species Human (GRCh38)
Location 11:24192362-24192384
Sequence CTACAGTTCAAGGTGAGATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25387
Summary {0: 24, 1: 735, 2: 6075, 3: 9138, 4: 9415}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079750689_1079750691 0 Left 1079750689 11:24192339-24192361 CCTCTCATGACACATGATGATTA No data
Right 1079750691 11:24192362-24192384 CTACAGTTCAAGGTGAGATTTGG 0: 24
1: 735
2: 6075
3: 9138
4: 9415
1079750687_1079750691 10 Left 1079750687 11:24192329-24192351 CCACGGAGTCCCTCTCATGACAC No data
Right 1079750691 11:24192362-24192384 CTACAGTTCAAGGTGAGATTTGG 0: 24
1: 735
2: 6075
3: 9138
4: 9415
1079750688_1079750691 1 Left 1079750688 11:24192338-24192360 CCCTCTCATGACACATGATGATT No data
Right 1079750691 11:24192362-24192384 CTACAGTTCAAGGTGAGATTTGG 0: 24
1: 735
2: 6075
3: 9138
4: 9415
1079750686_1079750691 11 Left 1079750686 11:24192328-24192350 CCCACGGAGTCCCTCTCATGACA No data
Right 1079750691 11:24192362-24192384 CTACAGTTCAAGGTGAGATTTGG 0: 24
1: 735
2: 6075
3: 9138
4: 9415
1079750685_1079750691 14 Left 1079750685 11:24192325-24192347 CCTCCCACGGAGTCCCTCTCATG No data
Right 1079750691 11:24192362-24192384 CTACAGTTCAAGGTGAGATTTGG 0: 24
1: 735
2: 6075
3: 9138
4: 9415
1079750683_1079750691 30 Left 1079750683 11:24192309-24192331 CCTCATGATTAAATTACCTCCCA 0: 179
1: 3380
2: 6600
3: 9708
4: 11553
Right 1079750691 11:24192362-24192384 CTACAGTTCAAGGTGAGATTTGG 0: 24
1: 735
2: 6075
3: 9138
4: 9415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079750691 Original CRISPR CTACAGTTCAAGGTGAGATT TGG Intergenic
Too many off-targets to display for this crispr