ID: 1079750693

View in Genome Browser
Species Human (GRCh38)
Location 11:24192367-24192389
Sequence GTTCAAGGTGAGATTTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079750685_1079750693 19 Left 1079750685 11:24192325-24192347 CCTCCCACGGAGTCCCTCTCATG No data
Right 1079750693 11:24192367-24192389 GTTCAAGGTGAGATTTGGATGGG No data
1079750687_1079750693 15 Left 1079750687 11:24192329-24192351 CCACGGAGTCCCTCTCATGACAC No data
Right 1079750693 11:24192367-24192389 GTTCAAGGTGAGATTTGGATGGG No data
1079750689_1079750693 5 Left 1079750689 11:24192339-24192361 CCTCTCATGACACATGATGATTA No data
Right 1079750693 11:24192367-24192389 GTTCAAGGTGAGATTTGGATGGG No data
1079750686_1079750693 16 Left 1079750686 11:24192328-24192350 CCCACGGAGTCCCTCTCATGACA No data
Right 1079750693 11:24192367-24192389 GTTCAAGGTGAGATTTGGATGGG No data
1079750688_1079750693 6 Left 1079750688 11:24192338-24192360 CCCTCTCATGACACATGATGATT No data
Right 1079750693 11:24192367-24192389 GTTCAAGGTGAGATTTGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079750693 Original CRISPR GTTCAAGGTGAGATTTGGAT GGG Intergenic
No off target data available for this crispr