ID: 1079755545

View in Genome Browser
Species Human (GRCh38)
Location 11:24255436-24255458
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079755543_1079755545 29 Left 1079755543 11:24255384-24255406 CCGTGCACAAATTTAGCAAAGAA No data
Right 1079755545 11:24255436-24255458 TATAACATGGAGCACCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079755545 Original CRISPR TATAACATGGAGCACCAACA TGG Intergenic
No off target data available for this crispr