ID: 1079756921

View in Genome Browser
Species Human (GRCh38)
Location 11:24275557-24275579
Sequence TAGAATCTTCACTGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079756921_1079756928 16 Left 1079756921 11:24275557-24275579 CCATGCTCCCAGTGAAGATTCTA No data
Right 1079756928 11:24275596-24275618 TGTTTCTTTCTCACTTATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079756921 Original CRISPR TAGAATCTTCACTGGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr