ID: 1079760146

View in Genome Browser
Species Human (GRCh38)
Location 11:24319148-24319170
Sequence AGAGAGAGTGCAAGGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079760146_1079760150 25 Left 1079760146 11:24319148-24319170 CCCACAATCCTTGCACTCTCTCT No data
Right 1079760150 11:24319196-24319218 TGTGCCATGCAGCCACTCCTAGG No data
1079760146_1079760151 26 Left 1079760146 11:24319148-24319170 CCCACAATCCTTGCACTCTCTCT No data
Right 1079760151 11:24319197-24319219 GTGCCATGCAGCCACTCCTAGGG No data
1079760146_1079760152 27 Left 1079760146 11:24319148-24319170 CCCACAATCCTTGCACTCTCTCT No data
Right 1079760152 11:24319198-24319220 TGCCATGCAGCCACTCCTAGGGG No data
1079760146_1079760153 28 Left 1079760146 11:24319148-24319170 CCCACAATCCTTGCACTCTCTCT No data
Right 1079760153 11:24319199-24319221 GCCATGCAGCCACTCCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079760146 Original CRISPR AGAGAGAGTGCAAGGATTGT GGG (reversed) Intergenic
No off target data available for this crispr