ID: 1079760654

View in Genome Browser
Species Human (GRCh38)
Location 11:24325456-24325478
Sequence CTGTGCATGAGTAACATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079760652_1079760654 20 Left 1079760652 11:24325413-24325435 CCTCTAAAACTTTAGATGAAAAG No data
Right 1079760654 11:24325456-24325478 CTGTGCATGAGTAACATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079760654 Original CRISPR CTGTGCATGAGTAACATTTA AGG Intergenic
No off target data available for this crispr