ID: 1079767084

View in Genome Browser
Species Human (GRCh38)
Location 11:24407190-24407212
Sequence TGTGCGGTCGGGCACTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079767084_1079767090 14 Left 1079767084 11:24407190-24407212 CCACCACAGTGCCCGACCGCACA No data
Right 1079767090 11:24407227-24407249 CTTCAAAACTTGAACAAATTTGG No data
1079767084_1079767091 15 Left 1079767084 11:24407190-24407212 CCACCACAGTGCCCGACCGCACA No data
Right 1079767091 11:24407228-24407250 TTCAAAACTTGAACAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079767084 Original CRISPR TGTGCGGTCGGGCACTGTGG TGG (reversed) Intergenic
No off target data available for this crispr