ID: 1079767932

View in Genome Browser
Species Human (GRCh38)
Location 11:24417272-24417294
Sequence GTTTTATAGTCAAGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079767929_1079767932 15 Left 1079767929 11:24417234-24417256 CCACATCTAGGGAAGATGATTGT No data
Right 1079767932 11:24417272-24417294 GTTTTATAGTCAAGGACAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079767932 Original CRISPR GTTTTATAGTCAAGGACAAA GGG Intergenic
No off target data available for this crispr