ID: 1079777653

View in Genome Browser
Species Human (GRCh38)
Location 11:24553895-24553917
Sequence GAGTTTCCTTGAGCTCTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079777653 Original CRISPR GAGTTTCCTTGAGCTCTCTT GGG Intronic
901096936 1:6689208-6689230 CTGTTTCCTTTAGCTCTCTCTGG - Intronic
901946892 1:12711470-12711492 GAGCTTCCCTAAGCTCACTTAGG + Intergenic
902739416 1:18424688-18424710 GCTTTTCTTTGAGCTATCTTTGG + Intergenic
902988707 1:20171314-20171336 AAGTCTCCTTGAGCTCACGTGGG + Intronic
905054998 1:35085668-35085690 GTCATTCCTAGAGCTCTCTTGGG + Intronic
905261985 1:36726183-36726205 CAATTTACTTGAGCTCTCTAAGG - Intergenic
907801149 1:57767004-57767026 GAGCTTCCATGACCTCTCTGAGG + Intronic
910189656 1:84582602-84582624 GATTTCACTTTAGCTCTCTTAGG + Intergenic
911021959 1:93398186-93398208 TTTTTTCCTTGAGCTGTCTTTGG - Intergenic
911104579 1:94119717-94119739 GAGTTTCCTTTTACTCTCTCAGG + Intronic
914691198 1:150029575-150029597 CGCTTTCCTTGAGCTTTCTTTGG - Intergenic
914999188 1:152572708-152572730 CAGTTTCTGTGAGCTATCTTGGG + Intronic
915191805 1:154157155-154157177 GAGTCTCCCTGGGCTCTGTTTGG + Intronic
915288180 1:154866033-154866055 GAATGTCCCTGAGCTCTCCTGGG + Intronic
918170092 1:181988321-181988343 GCTTTTGCTTGAGCTCTCTTAGG - Intergenic
920838828 1:209536823-209536845 GAGATTCCTTAAGTTCTCTCTGG - Intergenic
921183875 1:212653860-212653882 GCCTTTCTTTGAGCTCTCTTTGG - Intergenic
922327714 1:224544442-224544464 CAGTTTCCTGGAGCTATTTTAGG + Intronic
923958255 1:239047044-239047066 TAGTTTCTATGACCTCTCTTGGG + Intergenic
1065115965 10:22482620-22482642 CAGTTTCCATTAGCTCTATTAGG + Intergenic
1069075486 10:64034557-64034579 GACTTTCCCTCAGCTCTCCTAGG - Intergenic
1070246604 10:74738223-74738245 GAGTTTCCTTGCCCTCTTGTCGG + Intergenic
1071803566 10:89092050-89092072 GAATTTCCTTTAGGTCACTTTGG - Intergenic
1074723787 10:116286782-116286804 CATTTCCCTTGAACTCTCTTGGG + Intergenic
1079777653 11:24553895-24553917 GAGTTTCCTTGAGCTCTCTTGGG + Intronic
1080700418 11:34639661-34639683 GAGTTCGCTTGAGCTCACCTGGG - Intronic
1081612385 11:44570385-44570407 GTGTTTCCATGAGCTCTCCTGGG + Intronic
1081781134 11:45713671-45713693 TTGTTTCCTTGAGCTCCCTGAGG - Intergenic
1084943607 11:72627216-72627238 GAGTCTCCTTTGTCTCTCTTGGG - Intronic
1085581939 11:77659014-77659036 GAGTTTGCATGAGCTCTTTAGGG - Intergenic
1087116030 11:94525791-94525813 TAGTTCCTTTCAGCTCTCTTTGG - Intergenic
1088030238 11:105239785-105239807 CAGTTCCCTTGATATCTCTTGGG - Intergenic
1088704749 11:112451923-112451945 GAGGTTTCTTGAGCTGTCTTGGG - Intergenic
1091203857 11:133804311-133804333 GAGTTTCCTTGTGTTCCTTTGGG - Intergenic
1095166928 12:38983918-38983940 GAATTTCCATGAGATTTCTTTGG + Intergenic
1097952487 12:65447297-65447319 TAGTTTCCTTCATCTGTCTTTGG - Intronic
1100683538 12:96958510-96958532 TAGTTTCCTTAAGTTCTTTTTGG + Intergenic
1104174180 12:126313453-126313475 GAGTTTCCTTTGGCTGTTTTTGG + Intergenic
1105979088 13:25500271-25500293 GAGTTCCCTTGAATTCTCTAGGG - Intronic
1107786297 13:43961565-43961587 GAGTTTTCTTCAACTCTCCTAGG - Intergenic
1107996640 13:45867592-45867614 GAGTCTCCCTGAGCTCACTCTGG + Intergenic
1108581916 13:51835004-51835026 GAGCTTTCTGGAGCTCTCCTGGG - Intergenic
1109522061 13:63526333-63526355 GGCTTTCCCTGAGCTCTCTTTGG - Intergenic
1111000012 13:82165882-82165904 GAGCTTCCTTGTGCTCTTGTGGG - Intergenic
1111034961 13:82659983-82660005 GAGTTTCCTTGACCCCTTGTGGG - Intergenic
1111771615 13:92603574-92603596 AATATTCCTGGAGCTCTCTTAGG - Intronic
1112782081 13:102911921-102911943 TAGTTTCCTTGATCTCTGTGAGG + Intergenic
1114640660 14:24217605-24217627 GAGTTTCCTGGATCTCTTTGGGG + Intronic
1117071889 14:52065033-52065055 GAGATTTCTTGAACTCTCATAGG - Intronic
1119443796 14:74647389-74647411 GAGTCATCTTCAGCTCTCTTGGG - Intergenic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1128854023 15:70991985-70992007 GTATTTCCTTCAGCTCACTTGGG + Intronic
1131282539 15:91033073-91033095 GAGTTTCCTTGAGCTCTTGGTGG + Intergenic
1133367619 16:5223385-5223407 AAGCTTCCTTGAGCCCTTTTGGG - Intergenic
1135566254 16:23513385-23513407 GAGTTTCCCTGACCCATCTTGGG - Intronic
1135640415 16:24115117-24115139 GCCTTTCCTTGGACTCTCTTTGG - Intronic
1137938283 16:52656512-52656534 GAGTCTCCCTGGGCTCTGTTTGG - Intergenic
1137999332 16:53258277-53258299 GAGTATACTTGAGTTCTCTAAGG - Intronic
1138993507 16:62420450-62420472 TAGTTTCAGTGAACTCTCTTTGG - Intergenic
1139006743 16:62581624-62581646 GAGTGTCCTGAAACTCTCTTTGG - Intergenic
1139803453 16:69543497-69543519 GAGTTTCCATGTCCTCTCTGGGG - Intergenic
1144589697 17:16513738-16513760 GAAGTTCCTTGAGGTCTCTGAGG + Intergenic
1147047723 17:37767149-37767171 AAGATTCCTTGAACTCTCCTAGG + Intergenic
1147538418 17:41335580-41335602 GGGTGTGCTTGTGCTCTCTTGGG - Intergenic
1149830965 17:59871529-59871551 TAATTTCCTTGTACTCTCTTAGG + Intronic
1150458014 17:65323642-65323664 AAGTTTTCTTGAGATCTCTAGGG - Intergenic
1150610677 17:66730814-66730836 GAGCCCCCTTGTGCTCTCTTGGG - Intronic
1151380502 17:73722458-73722480 GTGTTTCTTTGAGGTCTGTTTGG - Intergenic
1152305551 17:79518479-79518501 GAGTTTCCCTGGGCTTGCTTAGG + Intergenic
1152416094 17:80163023-80163045 CACTTTCTTTGAGCTGTCTTTGG - Intergenic
1161463623 19:4414513-4414535 GTGTTTCCTAGAGATCTCTCTGG - Intronic
1164736985 19:30548859-30548881 GAGTCTCCTTGAGCTGACCTTGG - Exonic
1166243091 19:41507373-41507395 GAGTCTCCCTGGGCTCTGTTTGG - Intergenic
1166393535 19:42423453-42423475 GTGGCTCCTTGAGCCCTCTTTGG + Intronic
926880134 2:17536560-17536582 GAGTTTCCTGGAAGTTTCTTGGG - Intergenic
929344486 2:40864275-40864297 GAGTTCCCTGGAGTTCTTTTTGG - Intergenic
930774252 2:55157203-55157225 CATTTTCCTTGGGCTCACTTTGG - Intergenic
931119184 2:59197455-59197477 GAGTTTTCTTGGGCTCAGTTGGG + Intergenic
932437189 2:71709243-71709265 GTGTTTTCTGGAGCTCTGTTTGG + Intergenic
935115342 2:100130661-100130683 GAGTTTCCTGTAGTTCTTTTAGG + Intronic
936073319 2:109385546-109385568 GAGTTTCCTTGAACTGTCCAGGG + Intronic
936249541 2:110857331-110857353 GACTTTCCTTCATCTCTCATTGG + Intronic
938594389 2:132772446-132772468 GAGATTCCTGTAGTTCTCTTAGG + Intronic
938728493 2:134127565-134127587 GAGTGTCATGGAGCTCTCATGGG + Intronic
939355244 2:141093167-141093189 GAGTTTCCTTCTACTCTCTCTGG - Intronic
940243069 2:151584272-151584294 GAGGTTCCTTCAGTACTCTTAGG - Intronic
940244024 2:151594824-151594846 GAGGTTCCTTCAGTACTCTTAGG - Intronic
940244983 2:151605377-151605399 GAGGTTCCTTCAGTACTCTTAGG - Intronic
940293109 2:152097478-152097500 GAGTCACCTTGATCTTTCTTTGG - Intronic
940649817 2:156431113-156431135 GACTGTCCTTGAGTTTTCTTAGG + Intergenic
945222020 2:207493448-207493470 GAGTTTCCTGGAGCACAGTTTGG + Intergenic
948325509 2:237116728-237116750 GACCTTCATTGAGCTCTCTCAGG - Intergenic
948636275 2:239339862-239339884 CGGTTTCCTTGAACTCTCTGTGG - Intronic
1169232074 20:3896897-3896919 GAGTTTGCATGACCCCTCTTTGG - Intronic
1171044317 20:21796341-21796363 GAGTCTACCTGAGTTCTCTTTGG - Intergenic
1173415431 20:42850767-42850789 TATTTTCCTGGAGCTCACTTTGG + Intronic
1178599139 21:33980927-33980949 GCTTTTCCTAGAGCTGTCTTTGG - Intergenic
1178688924 21:34734599-34734621 GAGAGGCCTTGTGCTCTCTTAGG + Intergenic
1184053030 22:42022878-42022900 GACTTTTCTTGAGTTCTCCTTGG + Intronic
1185121490 22:48974298-48974320 GAGTTCCTTTGAGCTGTTTTGGG + Intergenic
951189800 3:19755011-19755033 GAGTGCCCTTGTGCTCTCTGAGG + Intergenic
953510061 3:43526848-43526870 GAGGTCCCTTAAGTTCTCTTAGG + Intronic
954424802 3:50437722-50437744 GAGTTGCCCTGGGCTCTCCTGGG - Intronic
956653772 3:71529919-71529941 AAGTTTCCTTGACCCCTCCTTGG - Intronic
959192208 3:103129139-103129161 GATTTTCTTTGATCTCTCTATGG + Intergenic
965603685 3:170479179-170479201 GAGTCTCTTTGGCCTCTCTTGGG + Intronic
967895218 3:194389819-194389841 AAGTTTCCTTGACTTCTCTTGGG - Intergenic
969100211 4:4762967-4762989 CAGTTTCCTTTACCTCACTTGGG - Intergenic
971464589 4:26942508-26942530 GTTTTTTCTTGAGCTCACTTAGG + Intronic
973882349 4:55286185-55286207 CAGTTTCCTTGTGTTCTTTTGGG - Intergenic
974081254 4:57215592-57215614 GGGTTTCCTTAATCTCTCTTAGG + Intergenic
976060688 4:81124744-81124766 GATTTTGCTTGAGGTCTCTCGGG - Intronic
977865426 4:102020541-102020563 GAGTTCCATTGGGCTCTCTTTGG + Intronic
978737526 4:112100776-112100798 GGTTTTCCTGGAGTTCTCTTGGG + Intergenic
981933542 4:150215429-150215451 GAGTTCCCATGACCCCTCTTTGG + Intronic
982355318 4:154460592-154460614 GGCTCTGCTTGAGCTCTCTTTGG + Intronic
983325935 4:166256967-166256989 GAGATTCATTGAGCCATCTTTGG + Intergenic
984832762 4:183991043-183991065 GAGTTTCCTTTCCCTTTCTTAGG + Intronic
986840927 5:11696721-11696743 GAGTGTCCCTGACCTCCCTTAGG - Intronic
986943618 5:12987610-12987632 GATTTTCCTTTACCTGTCTTGGG - Intergenic
987886781 5:23823564-23823586 GAGTCTCCCTGAGCTCTTTTCGG - Intergenic
990731836 5:58817019-58817041 GAGCTTCCATCAGCCCTCTTGGG - Intronic
992433305 5:76730966-76730988 GAGTTTCCATGCCCTCTCTTGGG + Intronic
995159029 5:108953477-108953499 GACTTTCCTTGAGGTCTGTTTGG + Intronic
996125257 5:119718726-119718748 GAGATTCCAGGAGCTGTCTTTGG + Intergenic
997598750 5:135125263-135125285 GTGTTTCTTTGGGATCTCTTTGG - Intronic
998226400 5:140330039-140330061 GAGTTACTTTGAACTCTCCTGGG - Intergenic
998733804 5:145111616-145111638 CAGTTTGCTTGAGCTGACTTTGG + Intergenic
998942256 5:147297167-147297189 TTGTTTCTTTGAGCTGTCTTTGG - Intronic
1001698940 5:173692640-173692662 GGGCTTCCTTGAGCCCTCTCTGG + Intergenic
1004939078 6:20536987-20537009 GAGATTCATTCAGCTATCTTGGG + Intronic
1005198669 6:23318377-23318399 GAGTTTCCTTGGGCTCTGAGTGG - Intergenic
1006593547 6:35176159-35176181 GAGATTCCATGATCTCTCTAGGG - Intergenic
1010382175 6:75237879-75237901 CAGTTTCATTCAGCTCTCTATGG - Exonic
1014563820 6:122923902-122923924 GAGTTTTCAAGACCTCTCTTTGG - Intergenic
1017385426 6:153877163-153877185 GTCTTTCCTTGAACTTTCTTTGG - Intergenic
1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG + Intergenic
1020877517 7:13716737-13716759 GGGTTTCCTCCAGCTTTCTTGGG - Intergenic
1024118998 7:46218642-46218664 GAGTTTCCTATTGCTCTCTAAGG + Intergenic
1025783333 7:64621284-64621306 GAGTTTCCTCGCTTTCTCTTGGG - Intergenic
1028266887 7:88736739-88736761 GAGTTTACATGAGATCTCTTAGG + Intergenic
1028640407 7:93036254-93036276 CAGGTTCCTTGATCTTTCTTTGG + Intergenic
1028803810 7:95000305-95000327 CAGTTTTCTTGAGATCTGTTAGG - Intronic
1029057585 7:97762390-97762412 GTGCTTCCTTTAGCTCTTTTAGG - Intergenic
1029938106 7:104450123-104450145 GAGTTTTCCTGAGGACTCTTAGG + Intronic
1031353768 7:120765848-120765870 GAGTTTCCATGCCCTCTCTGGGG + Intergenic
1031972340 7:128073874-128073896 GAGATTCCTTGAGGGCTCTGGGG + Intronic
1032315118 7:130830311-130830333 GAGCTTGCTTGCTCTCTCTTTGG - Intergenic
1036991403 8:13600452-13600474 AAGTTTCCTTGGACACTCTTCGG - Intergenic
1040405588 8:47099123-47099145 GCGCTTCCTTCAGCTCTTTTAGG + Intergenic
1041272604 8:56123732-56123754 CAGTTTTCATGAGCTCTTTTAGG - Intergenic
1043812807 8:84763288-84763310 CAGTTTCCTTGAGAACTCTCAGG - Intronic
1046028977 8:108760585-108760607 GAGCTTCCTGAAGCTCTCCTTGG - Intronic
1048622627 8:136151531-136151553 GATATCCCCTGAGCTCTCTTTGG + Intergenic
1050378051 9:4993655-4993677 CAGTCTCCTTGAGGGCTCTTAGG + Intronic
1055833460 9:80410427-80410449 GAGTTTCCTTGAATTCCCCTGGG + Intergenic
1057572615 9:96216088-96216110 GAGTTTCCCTGAGTTCCCATGGG + Intergenic
1059025739 9:110626872-110626894 GAGTTTTCTTCAGACCTCTTAGG + Intergenic
1059280793 9:113131996-113132018 CAGTGTCCTTGAGCTGTCCTTGG + Intergenic
1061111557 9:128575734-128575756 AAGCTTCCCTGGGCTCTCTTGGG + Intronic
1186196083 X:7111357-7111379 GAGTTTTCTGCAGGTCTCTTGGG - Intronic
1186240972 X:7565976-7565998 ATGTTTTCTTGAGCTCTCTTTGG + Intergenic
1198688310 X:139251274-139251296 GAGTTTCCTTCCCCTCTCCTAGG - Intergenic
1198720549 X:139614134-139614156 GGGTTCCCTTGAGCTGCCTTTGG - Intronic
1198776786 X:140188176-140188198 GTGTTTCCTTGTCCTCTTTTGGG + Intergenic
1199468329 X:148165577-148165599 GGCTTTCCTTGAGATTTCTTTGG + Intergenic