ID: 1079779552

View in Genome Browser
Species Human (GRCh38)
Location 11:24583588-24583610
Sequence GTGTCTACTTTCCCTTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079779552 Original CRISPR GTGTCTACTTTCCCTTATGA GGG (reversed) Intronic
900573843 1:3373367-3373389 GTGTCTACTTGCCCAGATGTGGG - Intronic
902123630 1:14189655-14189677 TTGTCTACTTTTTCTTTTGATGG - Intergenic
904570020 1:31456555-31456577 CTTCCTACTTTCCCTGATGAAGG + Intergenic
908137807 1:61151077-61151099 GTGTCTTCTTTCCTTTATCATGG + Intronic
908197707 1:61761503-61761525 GGGTCTTCCTTTCCTTATGAAGG - Intronic
908984787 1:70004636-70004658 GTGTCTACTTTCGGTTATACTGG + Intronic
909316856 1:74232468-74232490 GTCTCTCCATTCACTTATGAAGG + Intronic
909686077 1:78350454-78350476 GTTTCTAATTTCCATAATGAAGG - Intronic
909872562 1:80761334-80761356 GAATCTTCTTCCCCTTATGATGG - Intergenic
911006334 1:93228554-93228576 CTGTCTACCTTCCCTTATGAAGG + Intronic
911753231 1:101522914-101522936 GTGTCTTCATTTCCTTGTGAAGG + Intergenic
914935065 1:151971513-151971535 GAGTCTTCTTTCCCCTATAATGG - Intergenic
916897526 1:169180916-169180938 GTCTCTACTGTCCAATATGATGG - Intronic
919310382 1:195899272-195899294 GAGTCTCCATTTCCTTATGAAGG + Intergenic
924180217 1:241433414-241433436 GGGTCTTCGTTTCCTTATGAGGG + Intergenic
1064756425 10:18575599-18575621 CTTTCTACTCTCCCTGATGAGGG - Intronic
1069789341 10:71009731-71009753 GTGTCTATTTTCCTATTTGATGG + Intergenic
1069837101 10:71316452-71316474 GTGTCTACCCTACCTCATGAAGG + Intergenic
1070221682 10:74454707-74454729 GGGTCTTCATTTCCTTATGAAGG - Intronic
1070336567 10:75461011-75461033 GTATTTATTTTCCCTTACGAGGG - Intronic
1072866059 10:99062988-99063010 TTTTCTACTTTCCCTTGTCATGG + Intronic
1073935490 10:108626404-108626426 AAGTCTACTTTCACTTAAGATGG + Intergenic
1074936552 10:118187607-118187629 GTGTCTACTGTCCCTGCTGGAGG + Intergenic
1075634259 10:124019587-124019609 GGGTCTCCGTTTCCTTATGAAGG + Intronic
1075690010 10:124388388-124388410 GGGTCTTCATTTCCTTATGAAGG + Intergenic
1078178233 11:8987040-8987062 CTGGCTAATTACCCTTATGATGG + Intronic
1078449275 11:11428301-11428323 GTCTCTTCTTCCCCTTTTGAGGG + Intronic
1079779552 11:24583588-24583610 GTGTCTACTTTCCCTTATGAGGG - Intronic
1080040081 11:27750745-27750767 GCATCTACTTCCCCTTTTGAGGG - Intergenic
1082698377 11:56398907-56398929 GTGTATACTTTTCTTTGTGAAGG - Intergenic
1083554675 11:63616637-63616659 GGGTCTTCATTTCCTTATGAGGG + Intronic
1085364921 11:75931639-75931661 CTTTCTATTTTCCCTTATGATGG + Intronic
1086542652 11:87931450-87931472 GTGTCTACTTTTGCTTGGGAGGG + Intergenic
1087141701 11:94770427-94770449 GGCTCTACTTTTCCTTATGATGG + Intronic
1090021649 11:123133923-123133945 GGGGCTTCTTTTCCTTATGAAGG + Intronic
1090467077 11:126944239-126944261 GGGTCTTCATTCCCTTAAGAAGG + Intronic
1091913232 12:4249022-4249044 GAGTCTACTTTCCCTTAGGAAGG + Intergenic
1093271462 12:17067249-17067271 TTGTCTACTGTCCCTTATGAAGG - Intergenic
1093780170 12:23126509-23126531 GTGTCTTCATTTCCTTATGAGGG + Intergenic
1095162446 12:38933937-38933959 CTTTCTACTTTCCCTGATGAGGG + Intergenic
1095696732 12:45152460-45152482 GAGTCTTCATTTCCTTATGAGGG + Intergenic
1095973632 12:47923862-47923884 GTGTCCACTTTACCTTCTGTGGG + Intronic
1100701121 12:97149437-97149459 GTGTCCTTTTTCCCTTCTGATGG + Intergenic
1101307804 12:103547035-103547057 GGGTCTTCATTTCCTTATGAAGG + Intergenic
1102613255 12:114131060-114131082 GTCTCCACTCTTCCTTATGAGGG + Intergenic
1102702548 12:114852067-114852089 GAGTCAATGTTCCCTTATGAAGG - Intergenic
1105423063 13:20270220-20270242 CTGTTTACTTTCCATAATGAAGG - Intergenic
1107004824 13:35597845-35597867 GTGTCTACTCTTCCTTATTCTGG - Intronic
1107384595 13:39894300-39894322 GTGTCTCTATTTCCTTATGAAGG - Intergenic
1108185186 13:47881543-47881565 GGGTCTTATTTTCCTTATGAGGG - Intergenic
1108595706 13:51946729-51946751 GAGTCTGCTTTCCCCTATCAAGG - Intronic
1109642187 13:65204683-65204705 GTCTCTACAGTCCCTTATGATGG - Intergenic
1109677164 13:65692959-65692981 TTGTCTACTCTCCATTTTGAGGG + Intergenic
1110819698 13:79900249-79900271 GTGTCTGCATTCCTTTCTGAAGG - Intergenic
1111052371 13:82901594-82901616 GGGTCTTCTTTTCCTTATGAAGG - Intergenic
1112082307 13:95985994-95986016 GTTTTTTCTTTCCCTTATGGAGG - Intronic
1113064930 13:106363280-106363302 TAGTCTATTTTTCCTTATGAAGG - Intergenic
1115656116 14:35445358-35445380 GGGTCTTCCTTTCCTTATGAAGG - Intergenic
1115836378 14:37409226-37409248 GTGTCTGCTGTCACTCATGATGG - Intronic
1118363476 14:65075094-65075116 GTGTCTTCTTACCCTTGTTAAGG - Intronic
1120019823 14:79515880-79515902 GTGGCTTCTTTCCCTTCTGGGGG + Intronic
1122238611 14:100347022-100347044 GTGTCTGCTTTGCCTGATGCAGG - Intronic
1122336138 14:100986396-100986418 GTGTCTTCTTTGGCTAATGATGG + Intergenic
1122351123 14:101092655-101092677 TTGTATACTTTTCCTTATTAAGG - Intergenic
1122808261 14:104272575-104272597 GTGTCTACTTTTCCAAATGTGGG - Intergenic
1124396771 15:29309026-29309048 GGGTCTTCATTTCCTTATGAGGG + Intronic
1125690233 15:41590203-41590225 CTTTCTACTCTCCCTGATGAGGG - Intergenic
1129761663 15:78132230-78132252 GGGTCTTCATTTCCTTATGAGGG - Intronic
1131795265 15:96009900-96009922 GTGTCTTTTTTCCCTTCTGGAGG + Intergenic
1133960810 16:10491898-10491920 CTTTCTACTTTCCCTGATGAAGG - Intergenic
1137849109 16:51720894-51720916 GTGTCCACCTTCCCATATGGCGG - Intergenic
1138924819 16:61578774-61578796 GTATCTACATTCTCATATGAAGG + Intergenic
1144942804 17:18952976-18952998 GTGTCCACCTTCCCTCAGGAAGG - Intronic
1145256136 17:21323500-21323522 GTGTCCACTTTCCCTGAAGATGG - Intergenic
1145320477 17:21764450-21764472 GTGTCCACTTTCCCTGAAGATGG + Intergenic
1147442084 17:40453559-40453581 CTGGCTAATTTCCCTTCTGAAGG + Intronic
1149811974 17:59684346-59684368 GTATAAACTTTCTCTTATGAAGG + Intronic
1151428362 17:74046087-74046109 GTGTCTACATTGCTTAATGACGG + Intergenic
1151922860 17:77170753-77170775 CTTTCTACTTTTCCTGATGAGGG + Intronic
1151971932 17:77462195-77462217 GGGTCTTCATTTCCTTATGAAGG - Intronic
1152992824 18:378336-378358 CTGTCTACTTTTATTTATGACGG - Intronic
1156809586 18:41231032-41231054 GTGTCTACTCTGTCTAATGAAGG + Intergenic
1160417215 18:78719828-78719850 GTGTCTTCATTCCGTTATGAAGG + Intergenic
1162267904 19:9590999-9591021 CTTTCTACTCTCCCTGATGAGGG + Intergenic
1162273058 19:9631937-9631959 CTTTCTACTTTTCCTTATGAGGG - Intronic
1164321893 19:24156187-24156209 GTGCCTAGTTTCTTTTATGAGGG - Intergenic
1168199222 19:54802278-54802300 TTGTCTTGTTTCACTTATGAAGG + Intronic
930054522 2:47241682-47241704 GGGTCTTCATTTCCTTATGAGGG - Intergenic
930689435 2:54345209-54345231 GGGTCTTCATTTCCTTATGAAGG - Intronic
930920053 2:56742155-56742177 GGGTCTTCTTTTCCTTATTAGGG + Intergenic
931556905 2:63516422-63516444 CTGACTACTTTGCCTCATGATGG + Intronic
931754923 2:65364438-65364460 ATGCCTTCTTTCCCTTTTGAGGG - Intronic
931812664 2:65869628-65869650 CTGACTTCTTTCCCTTATTAAGG - Intergenic
932022945 2:68106404-68106426 TTGTCTAGTTTCCCTTGTCAAGG + Intronic
935760890 2:106319717-106319739 GAGTCTGCATTTCCTTATGAAGG + Intergenic
935769548 2:106404101-106404123 GTGTCTAAAATCCCTTCTGATGG + Intronic
935910546 2:107891827-107891849 GTGTCTAAAATCCCTTCTGATGG - Intergenic
935958638 2:108402350-108402372 TTTGCTACTTTCCCTGATGAGGG - Intergenic
935968668 2:108508667-108508689 GTGTCTAAAATCCCTTCTGATGG - Exonic
936132340 2:109856970-109856992 GTGTCTAAAATCCCTTCTGATGG - Exonic
936212357 2:110514515-110514537 GTGTCTAAAATCCCTTCTGATGG + Exonic
936421497 2:112369082-112369104 GTGTCTAAAATCCCTTCTGATGG + Intergenic
936716424 2:115192036-115192058 CTTTCTACTTTCCCTGATGAAGG + Intronic
936882206 2:117267155-117267177 TTGTCTACTTTTCCTTATGGTGG - Intergenic
937984024 2:127630568-127630590 CTGTCTCCTTTCCCTTGGGAGGG - Intronic
938091105 2:128435400-128435422 GAGTCTGCCTTTCCTTATGAAGG + Intergenic
939475572 2:142681915-142681937 GTGTATTCACTCCCTTATGAAGG + Intergenic
940121316 2:150269618-150269640 GGGTCTTCATTACCTTATGAAGG + Intergenic
940661928 2:156557016-156557038 GTCTATACTTTCCTTTATAATGG - Intronic
942547246 2:177078166-177078188 GGGTCTTCATTTCCTTATGAAGG - Intergenic
943311189 2:186326678-186326700 GGGTCTTCATTTCCTTATGAAGG + Intergenic
943325195 2:186489086-186489108 GTGTCCACTTGCCTTTAAGAAGG + Intronic
943436488 2:187870413-187870435 GGGTCTTCATTTCCTTATGAAGG - Intergenic
943684329 2:190801790-190801812 GTATCTGCTTTGCCTTCTGAAGG - Intergenic
944393672 2:199245982-199246004 TTGTCTAATTGCCCTTATGCAGG + Intergenic
944664406 2:201947858-201947880 GAGTCTTCATTTCCTTATGAGGG + Intergenic
944970172 2:204983885-204983907 GGGTCTTCGTTTCCTTATGAGGG + Intronic
944987920 2:205200030-205200052 GTGTCTCCTTTCCTTTTTGATGG + Intronic
945483493 2:210368352-210368374 CTTCCTACTTTCCCTGATGAAGG + Intergenic
946814011 2:223557265-223557287 GTGTCTCCTTTATCTTATTAAGG - Intergenic
1168824100 20:797515-797537 CTTTCTACTCTCCCTGATGAGGG - Intergenic
1177181166 21:17745997-17746019 GGGTCTTCATTTCCTTATGAAGG - Intergenic
1177228095 21:18283172-18283194 GTGTCTACTTTAGCCTATGTAGG + Intronic
1177361756 21:20081985-20082007 GGTTCTATTTTCCCTTATAAGGG - Intergenic
1179035374 21:37754829-37754851 GTGGCTAGTTTCCCTTTTGGGGG + Intronic
1179491643 21:41745048-41745070 TTGCCTTCTTTCCCTTATCAGGG + Intronic
1183067627 22:35374052-35374074 GAGTCTTCTTTTCCTTAGGACGG + Intergenic
1184064430 22:42109208-42109230 CTTTCTACTCTCCCTGATGAAGG + Intergenic
949681047 3:6514900-6514922 GAGTCTTCATTTCCTTATGAGGG + Intergenic
950594399 3:13966068-13966090 CTTTCTACTCTCCCTGATGAAGG + Intronic
950782656 3:15405304-15405326 CAGTCTACTTTCCCTTCTGAAGG - Intronic
950846237 3:16018584-16018606 CTTTCTACTCTCCCTGATGAGGG + Intergenic
951679482 3:25280085-25280107 GGGTCTTCATTTCCTTATGAAGG - Intronic
953671633 3:44967629-44967651 CGGTCTACTTTCCCTTTTCATGG + Intronic
954600427 3:51863391-51863413 GTGTCTACTGTCCCTATTAAAGG + Exonic
955040502 3:55313352-55313374 TGGTCTACTTTCCCAAATGATGG + Intergenic
955310578 3:57882589-57882611 ATGGCTAATTTCCCTTATAATGG - Intronic
955654316 3:61228497-61228519 GGGTCTTCATTTCCTTATGAGGG + Intronic
957313684 3:78550766-78550788 CTTTCTTCTTTCCCTCATGATGG + Intergenic
957543664 3:81608923-81608945 GAGTCAACGTTTCCTTATGAAGG - Intronic
958671529 3:97211589-97211611 GTTTCTTCATTCCCTTATAAGGG + Intronic
959077827 3:101769290-101769312 GTCTCTTCTTTCCTTTATGATGG - Exonic
959604024 3:108222439-108222461 GAGTCTAGTTTCCCTGGTGACGG - Exonic
960506181 3:118497502-118497524 GTTTGCACTTTCCATTATGATGG - Intergenic
961671664 3:128536610-128536632 GTCTCTACTTTCCTCTATGTGGG - Intergenic
961939812 3:130625268-130625290 TTGTCCATTTTCCCTTATGTTGG + Intronic
963382132 3:144543825-144543847 ATGTCTCCTATCCCTTCTGATGG + Intergenic
964574601 3:158151187-158151209 ATGTCTTCATTTCCTTATGAAGG - Intronic
965183716 3:165436654-165436676 GTGTCTTCATTTCTTTATGAAGG - Intergenic
967237851 3:187405118-187405140 GTTTCAACTTTCCCTTCTGTAGG + Intergenic
968730031 4:2265205-2265227 CTGTCTCCTTTCCCTCACGACGG + Intergenic
970822663 4:20237058-20237080 GTCTCTATTTTCCCATAAGAGGG + Intergenic
972281551 4:37606565-37606587 GTGTCTTCTTTCCTGTGTGAGGG - Intronic
972655246 4:41057787-41057809 GTTTCTCCTTTCCCTTCTGGAGG + Intronic
973663234 4:53130191-53130213 GTTTATAATTTCCTTTATGATGG - Intronic
975571817 4:75825689-75825711 GGGTCTCCATTTCCTTATGAAGG - Intergenic
975820080 4:78261798-78261820 GGGTCTTCATTTCCTTATGAAGG + Intronic
978518704 4:109596465-109596487 GTGTCTACTGTCCCTATTAAAGG - Intronic
978960960 4:114678038-114678060 GTGTCTTTTTTCCCTTTTAACGG - Exonic
980760446 4:137226033-137226055 TTGTTTACTATCCCTTACGAAGG + Intergenic
982382054 4:154759685-154759707 GTTTCTTCTTTGCCTTATGGGGG - Intergenic
983291079 4:165806474-165806496 GTGCCTTCATTTCCTTATGAAGG + Intergenic
984588466 4:181589679-181589701 GGGTCTTCATTTCCTTATGAAGG - Intergenic
984893767 4:184517104-184517126 CTGGTTACTTTCCCTTAGGAGGG + Intergenic
986932278 5:12840693-12840715 GTGTCTTCTTTCTCTTGTAAGGG + Intergenic
987277872 5:16380560-16380582 GTTTCTTCATTTCCTTATGAAGG + Intergenic
987455927 5:18146529-18146551 GTGTCTAGTTTCCCATATATAGG + Intergenic
990860996 5:60327181-60327203 GGGTCTTCATTTCCTTATGAGGG - Intronic
990861138 5:60329081-60329103 GGGTCTTCATTTCCTTATGAGGG + Intronic
991580893 5:68154266-68154288 TTGTTTACTGTCCCTTGTGAGGG - Intergenic
992736910 5:79730959-79730981 GTGTCTTCCTTCTCTTCTGATGG - Exonic
994254948 5:97581755-97581777 GGGTCTTCATTTCCTTATGAAGG - Intergenic
994635462 5:102340360-102340382 CTTTCTACTTTCCCTGAAGACGG + Intergenic
994785816 5:104161211-104161233 GTGTCTGCTTTCTCTTTTTATGG + Intergenic
994975450 5:106798533-106798555 TTGTATATTTTCCATTATGAAGG - Intergenic
995689056 5:114803120-114803142 GTGGCTCCCTTCCCTTCTGAGGG + Intergenic
996914778 5:128699238-128699260 GTGTCTACTTTCCTCTAAGAGGG - Intronic
998409482 5:141898387-141898409 GGGTCTTCATTTCCTTATGAAGG + Intergenic
998543923 5:143009636-143009658 GTGTTTACTTTATCTTATCACGG - Intronic
1000430555 5:161147398-161147420 GTTTTTAATTTCCCTAATGATGG + Intergenic
1001464475 5:171951233-171951255 GTGGCTAGTTTTCCTTTTGAGGG - Intronic
1001861955 5:175063718-175063740 GGGTCTTCATTTCCTTATGAGGG + Intergenic
1003660314 6:8054629-8054651 GCGTTTTCTTGCCCTTATGAAGG + Intronic
1004102084 6:12623324-12623346 GTGTCTACGTCTCCTTATTAAGG - Intergenic
1004442784 6:15669912-15669934 GGGTCTTCATTTCCTTATGAAGG + Intergenic
1006049635 6:31331817-31331839 CTTTCTACTCTCCCTGATGAAGG + Intronic
1007006887 6:38372593-38372615 GTGTTTACTTTCCCTTTTTAGGG + Intronic
1007714299 6:43845546-43845568 GTGTCTTCTTTCCTACATGATGG + Intergenic
1011025900 6:82868765-82868787 GTGGCTCCTTGTCCTTATGAGGG - Intergenic
1011262601 6:85484708-85484730 GTGTATTTTTTCCCTTATAAGGG - Intronic
1012424015 6:99094682-99094704 GTGTCTTCATTCCCTTTTGAAGG - Intergenic
1013026892 6:106283949-106283971 GTGTCTTCTTTCACTTAACATGG + Intronic
1014821478 6:125992973-125992995 GGGTATAGTTTCCCTTTTGATGG + Intronic
1015678528 6:135778779-135778801 GTTTTTACTACCCCTTATGATGG - Intergenic
1017749702 6:157479901-157479923 CTGTCTACTTTCACTCATGGAGG - Intronic
1018757962 6:166865889-166865911 GTGTCTCTTTTCTCTTAGGAAGG + Intronic
1019837940 7:3409252-3409274 GCCTCCCCTTTCCCTTATGATGG + Intronic
1021111961 7:16705917-16705939 GTGACTATTTTACCTTATAATGG + Intronic
1021930191 7:25573023-25573045 ATCTCTACTTTCCCTAATGAAGG - Intergenic
1023616737 7:42027793-42027815 GTTTCTGCTTTCCTTTATTAAGG - Intronic
1024980465 7:55153672-55153694 ATGTTTAATTTCCCTTATAAAGG - Intronic
1027751992 7:82161005-82161027 GGGTCTTCATTTCCTTATGAAGG - Intronic
1030056587 7:105588643-105588665 TTGTCTTCTCTCCCTTATTAAGG - Intronic
1030668543 7:112308827-112308849 GGGTCTTCATTTCCTTATGAAGG - Intronic
1031659862 7:124409146-124409168 GTGTCTATTTTTCCTACTGAAGG - Intergenic
1032555662 7:132831116-132831138 GTGTAAACTTTTCATTATGAAGG + Intronic
1032906599 7:136374658-136374680 GTGTATTCTTTGCCTTATAAAGG - Intergenic
1033097640 7:138444701-138444723 CTTTCTACTCTCCCTGATGAGGG + Intergenic
1034673391 7:152873438-152873460 GTTTCTTCTTTCCCTTATCGAGG - Intergenic
1035056134 7:156038151-156038173 GAGCCTACTTTTCCTTAAGAGGG + Intergenic
1036104506 8:5825459-5825481 CTTTCTACTCTCCCTGATGAAGG + Intergenic
1040983585 8:53269776-53269798 TTGTCTACTTTCCCTGATGATGG + Intergenic
1041322618 8:56630347-56630369 GGGTCTTCGTTTCCTTATGAAGG - Intergenic
1041747989 8:61230222-61230244 GTTTCTACTTTTCTTTGTGAGGG + Intronic
1042003525 8:64154678-64154700 GGGTCTTCCTTTCCTTATGAAGG - Intergenic
1042857672 8:73284517-73284539 ATGTCTTTTTTCACTTATGATGG - Intergenic
1049637452 8:143696716-143696738 GTGTCACCTTTTCCTTGTGAGGG + Intronic
1051278404 9:15418530-15418552 GGGTCTTCATTTCCTTATGAAGG + Intergenic
1054780425 9:69161057-69161079 GTGTCAGCTTTCCCTGCTGATGG + Intronic
1057583731 9:96310943-96310965 CTGTCTACTCTTCCTTATGAGGG + Intergenic
1058846752 9:108968072-108968094 GTGCCTGCTTTCCCTGAAGAGGG - Intronic
1061446121 9:130639138-130639160 GTGTCTGCTTTCACGTCTGAGGG + Intergenic
1061829350 9:133280999-133281021 CTTTCTACCTTCCCTGATGAGGG + Intergenic
1062113146 9:134793317-134793339 CTGTCTTCTTGCCCTTAGGAAGG - Intronic
1186080802 X:5929793-5929815 GGGTCTTCATTGCCTTATGAAGG - Intronic
1187862531 X:23695981-23696003 GTGTTTTCTTTCCCTTCTGTTGG - Intergenic
1188034382 X:25300439-25300461 GGGTCTTCATTTCCTTATGAAGG + Intergenic
1189074578 X:37902885-37902907 GAGTCTCCTTTCCCTTGTAATGG - Intronic
1195925396 X:110019596-110019618 GTGTTTACCATCCCTGATGAAGG - Intronic
1197509095 X:127348752-127348774 GTGTCTACTTTTCCTTGAGGTGG - Intergenic
1200317554 X:155149447-155149469 GTGTATACTTATCCTTATGAAGG - Intergenic
1200367115 X:155678374-155678396 GTTTTTACTGTCCCTTCTGAAGG - Intergenic
1201253252 Y:12082059-12082081 GAGATTACTTTCCCTTGTGAGGG - Intergenic
1201911863 Y:19140893-19140915 GACTCTACTTTTCCTGATGAGGG - Intergenic