ID: 1079779849

View in Genome Browser
Species Human (GRCh38)
Location 11:24587816-24587838
Sequence AGGCAAACAGCTGTGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 393}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079779849 Original CRISPR AGGCAAACAGCTGTGGTGAG AGG Intronic
900323435 1:2095942-2095964 AGTCAAACAGGTGAGGGGAGGGG - Intronic
900867485 1:5278624-5278646 AGGCCAACATCTGTGCAGAGTGG - Intergenic
900872573 1:5314573-5314595 AGGCAAACAGTTGTGGAGGGTGG - Intergenic
901214989 1:7550341-7550363 AGGCAAAAAGGAATGGTGAGTGG - Intronic
901345202 1:8534096-8534118 AGACCACGAGCTGTGGTGAGTGG + Intronic
902569172 1:17335923-17335945 AGGGGAACAGGTGTGGTCAGAGG + Intronic
903279669 1:22243509-22243531 AGGCAAAGAGCTCTGGGGTGAGG + Intergenic
904094431 1:27966276-27966298 CAGCAAAGCGCTGTGGTGAGGGG + Intronic
904768899 1:32870378-32870400 AGGCAAAGACCTGGGGTTAGGGG + Intronic
905503856 1:38460777-38460799 AGACAAAGAGCTGGGGTGGGAGG + Intergenic
905629209 1:39509620-39509642 AGGCGAACAGCTGTGCGGGGCGG - Intronic
906024527 1:42661983-42662005 AGGGAAACAGTTGTGGAGACTGG - Intronic
906913553 1:49982753-49982775 GGACAATCAGCTGTGGAGAGGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
909923687 1:81413149-81413171 AGGCAAACGGCTGAGGTGGGTGG - Intronic
912706550 1:111919323-111919345 GGGCACACAGCTGAGGTGGGTGG + Intronic
913531081 1:119734854-119734876 TGGTAACCAGCTGTGGGGAGAGG + Intronic
914044052 1:144077037-144077059 AGGCAAAAAGCTGCGGTGGCGGG - Intergenic
915459139 1:156059403-156059425 AAACAGACAGCTGGGGTGAGTGG - Intergenic
915972147 1:160362548-160362570 AGGCTGAAAGCTGTGCTGAGAGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917743198 1:177981831-177981853 AGACACACACCTGTGGTGGGTGG + Intronic
919056767 1:192580885-192580907 AGGCACACAGCAATGGTAAGGGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919988048 1:202689499-202689521 TGGCAAACAGCTCTGTGGAGTGG + Intronic
920113774 1:203605166-203605188 AGGGAAACACGTGTGGTGAGAGG - Intergenic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920653156 1:207853599-207853621 ATGGAGACAGATGTGGTGAGAGG - Intergenic
921572925 1:216800164-216800186 GGGCAGACAGCTGTGTTGAGAGG - Intronic
921950005 1:220919592-220919614 ATGTAAACAGCTCTGGGGAGGGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924521895 1:244812744-244812766 AGTCAGAAAGCTGAGGTGAGAGG + Intergenic
1062958614 10:1556781-1556803 AGGGACAGAGCTGTGGTCAGGGG - Intronic
1063282842 10:4649493-4649515 AGGCAAAGAGAGGTGGTCAGTGG - Intergenic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066244767 10:33571710-33571732 AGGCAAAGAGCAGGGGTGAGGGG - Intergenic
1066318330 10:34272615-34272637 AGCCACCCAGCTGAGGTGAGAGG + Intronic
1066954263 10:42149970-42149992 GGGCAAAAAGCTGCGGTGATGGG + Intergenic
1067098356 10:43317035-43317057 AAGCACAGTGCTGTGGTGAGTGG - Intergenic
1067224741 10:44368326-44368348 ATGCAATCAGCCGTGCTGAGGGG + Intergenic
1068553802 10:58435476-58435498 AGGCTCACTGATGTGGTGAGTGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1070704222 10:78625933-78625955 AGGCAAACAGGTGAGGAGCGAGG - Intergenic
1070760695 10:79022708-79022730 ATCCAATCAGCTGTGGTGGGCGG - Intergenic
1070843396 10:79503529-79503551 AGGCAGAGATCGGTGGTGAGAGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1071600491 10:86956472-86956494 AGCCAAACAGGTCTGGTGTGTGG + Intronic
1071697906 10:87897687-87897709 AGGAAAACAGCAGTAGTAAGAGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1074280674 10:112048665-112048687 AGGCAAGCATCAGTAGTGAGTGG + Intergenic
1074833714 10:117268647-117268669 AGGCATGCAGGTGTGCTGAGTGG - Intronic
1075448574 10:122530995-122531017 AGACAGACATCTGTGGGGAGGGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076670887 10:132120613-132120635 AGGGCATCAGCTGTGGTGAGAGG + Intronic
1078725220 11:13924009-13924031 AGACCAACAGCTTTGGGGAGAGG - Intergenic
1078774080 11:14378412-14378434 AGCCAATCAGCTGTGTGGAGTGG - Intergenic
1079117662 11:17650895-17650917 AGGGGAACAGCTCTGGTGAAGGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079779849 11:24587816-24587838 AGGCAAACAGCTGTGGTGAGAGG + Intronic
1080616507 11:33949218-33949240 GGGCAAAGAGCTGGGGGGAGTGG + Intergenic
1082784001 11:57306884-57306906 AGGCAGAGAGCTGTGGTGGTGGG + Intronic
1083832541 11:65241953-65241975 AGGCAGAAGGCAGTGGTGAGGGG - Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086192608 11:84097464-84097486 AGCCAAAGAGCTGTGGAGTGGGG - Intronic
1086573002 11:88306519-88306541 CGGCACAGAGCTGTGGAGAGTGG + Intronic
1088062390 11:105671053-105671075 AAGCAACCAGCTGTGGTAAAAGG - Intronic
1089961638 11:122622148-122622170 AAGAAAACAGCAGTGGGGAGAGG + Intergenic
1090890945 11:130921926-130921948 AGACAAACAGCTGTGAGGAGAGG + Intergenic
1091104053 11:132901970-132901992 ACGCAAACACCGGTGGTGGGGGG - Intronic
1092822737 12:12368317-12368339 AGGCAAAATGCTGTGCAGAGAGG - Intronic
1092964303 12:13626834-13626856 AGATAAAGAGCTATGGTGAGGGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094142479 12:27195376-27195398 AGGCAATCAACTGAGGAGAGTGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095291829 12:40486760-40486782 CGGCCATCAGCTGTGGTGACAGG + Exonic
1095291948 12:40487540-40487562 CGGCCATCAGCTGTGGTGACAGG + Exonic
1095292100 12:40488560-40488582 TGGCCATCAGCTGTGGTGACAGG + Exonic
1095292235 12:40489520-40489542 CGGCTATCAGCTGTGGTGACAGG + Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096811400 12:54172783-54172805 AGGAATACATATGTGGTGAGTGG - Intronic
1096880878 12:54669230-54669252 AGGAAAACAGTTGTGGGGTGGGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1099778346 12:87163026-87163048 AGGCAGACAGCTGTGGGGGCAGG - Intergenic
1103562084 12:121798093-121798115 ACCCAGACAGCTGGGGTGAGGGG + Intronic
1103911358 12:124354343-124354365 AGGGAGACAGCTGTGAAGAGGGG + Intronic
1105073450 12:133252745-133252767 AGGCAAGCTGGTGGGGTGAGGGG - Intergenic
1106789978 13:33145056-33145078 AGGCAAACATCTGAGTTTAGGGG - Intronic
1107401932 13:40077710-40077732 ATCCAATCAGCTGTGGTCAGGGG - Intergenic
1108018878 13:46104882-46104904 AGGCAAACAAGTGAGGAGAGTGG + Intronic
1108095760 13:46898776-46898798 ACGCTTACAGATGTGGTGAGTGG - Intergenic
1108723913 13:53160409-53160431 AGGAAGACAGCTGGGCTGAGGGG + Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111494872 13:89034691-89034713 AGGCAAACAGATGTCATGGGTGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1112003214 13:95231106-95231128 AGGCTGACAACTGTGGAGAGGGG + Intronic
1112244777 13:97722268-97722290 AGGCAGAAAGGTGTGGAGAGAGG + Intergenic
1112306670 13:98280481-98280503 AGACAGAGAGCTGGGGTGAGCGG - Intronic
1112752797 13:102598665-102598687 AGGAAAACAGCTGGGATAAGTGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114472484 14:22973389-22973411 AGACAAACTGCTGTGGCCAGTGG - Exonic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119469516 14:74885848-74885870 ATCCAAACACCTGTGGAGAGTGG - Intronic
1119476284 14:74931742-74931764 AGGCAAGAGGCTGAGGTGAGAGG + Intergenic
1122328668 14:100898617-100898639 AGGTAAACACCAGTGGGGAGGGG - Intergenic
1122366303 14:101196856-101196878 AGGCATAAGGCTGGGGTGAGGGG + Intergenic
1122394251 14:101411558-101411580 ATGCCAAGAGCTGTGGTGCGTGG - Intergenic
1122415539 14:101547955-101547977 AGGAAAACAGCGATGGTGGGGGG - Intergenic
1123068117 14:105628273-105628295 AGGCAAACAGGAGAGGGGAGGGG - Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123813691 15:23955118-23955140 AGGCAGACAGCAGGAGTGAGTGG + Intergenic
1126376286 15:48000157-48000179 AGGCACAGAGATGTGGTGAGAGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127843350 15:62848707-62848729 AAGAAGACAGCTGTGGTGGGTGG - Intergenic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131246187 15:90795787-90795809 AGGATAAGAGCTGTGGTGAATGG + Intronic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132160680 15:99538683-99538705 TGCCAAACAGCTGTGATGAGAGG + Intergenic
1134315011 16:13110681-13110703 AGCCAAAGAGCTGTGATGAAGGG + Intronic
1136099363 16:27982255-27982277 ACTCAAAAAGCTGTGGTGGGAGG + Intronic
1136696393 16:32084959-32084981 CGACAAAAAGCTGTGGTGACGGG + Intergenic
1136696494 16:32085390-32085412 AGGCAAAAAGCTGCGGTGGCAGG + Intergenic
1136784249 16:32925388-32925410 GGGGAAACAGGAGTGGTGAGAGG - Intergenic
1136796888 16:33028211-33028233 CGACAAAAAGCTGTGGTGACGGG + Intergenic
1136796992 16:33028664-33028686 AGGCAAAAAGCTGCGGTGGCAGG + Intergenic
1136885535 16:33928418-33928440 GGGGAAACAGGAGTGGTGAGAGG + Intergenic
1137084352 16:36101855-36101877 GGGCAAAAAGCTGCGGTGACTGG + Intergenic
1138046421 16:53729885-53729907 GGACAAACAGCTATAGTGAGGGG - Intronic
1138179128 16:54930624-54930646 AGGCAAAGAGGAGGGGTGAGAGG + Intergenic
1138445792 16:57062459-57062481 AAACAGAAAGCTGTGGTGAGGGG - Intronic
1139422306 16:66856228-66856250 AGGCAGGCAGCTGTGGTAACAGG + Intronic
1139958193 16:70703315-70703337 AGGCAGAGAGCTGGGGTGGGAGG + Intronic
1140185613 16:72767658-72767680 AGGCAATAAGCTGTGGTGTCAGG + Intergenic
1140396517 16:74631844-74631866 AGGCAATCAGCTGAGGTCAGGGG - Intronic
1141953259 16:87353004-87353026 AGGCCAACACCTTTAGTGAGGGG - Intronic
1203086906 16_KI270728v1_random:1189394-1189416 GGGGAAACAGGAGTGGTGAGAGG - Intergenic
1142774180 17:2123246-2123268 TGGCAAACAGCTGCTGAGAGGGG + Intronic
1143471802 17:7179905-7179927 AGGCACACAGTAGTAGTGAGTGG - Intergenic
1143480290 17:7224226-7224248 AGGCAAACAGCTGAGGCGGTAGG + Exonic
1144127121 17:12213585-12213607 AGGCAGACTGCTCTGCTGAGTGG - Intergenic
1144319747 17:14102961-14102983 AGGAAAACAGCTTGGCTGAGTGG + Intronic
1145327140 17:21842181-21842203 CGGCAAAAAGCTGTGGCGACGGG - Intergenic
1145327479 17:21843483-21843505 CGGCAAAAAGCTGTGGAGACGGG - Intergenic
1145690060 17:26731179-26731201 GGGCAAAAAGCTGCGGTGACGGG - Intergenic
1147133682 17:38423155-38423177 ATGCAAACTGCTGTGTTGGGTGG - Intergenic
1148013884 17:44507132-44507154 AGGGAAACAGGGGTGGAGAGAGG - Intergenic
1148139649 17:45318986-45319008 AGGCAAACAGGTGGTGGGAGAGG - Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149397034 17:56255393-56255415 GGGCAAACCTCTGTGGTTAGGGG - Intronic
1149662838 17:58344525-58344547 ATGGAAACAGTTGTGGGGAGGGG - Intergenic
1149666564 17:58368973-58368995 AGGCCCACAGCTGTGGAAAGGGG + Intronic
1150199504 17:63340187-63340209 AGGCTGTCAGCTGAGGTGAGCGG - Exonic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151144144 17:72023997-72024019 ACCCAAACAGCTGAGATGAGAGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152424633 17:80212265-80212287 AGTCCAACTCCTGTGGTGAGGGG + Exonic
1152703035 17:81828906-81828928 AGGCACACAGCTGAGGGGGGAGG + Intronic
1203191951 17_KI270729v1_random:198984-199006 CGGCAAAAAGCTGTGGCGACGGG - Intergenic
1153198383 18:2625304-2625326 AGGCCATCAGCCCTGGTGAGAGG + Intergenic
1153206900 18:2712938-2712960 AAGAAAACAGTTGTGGTTAGAGG - Intronic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153849164 18:9077265-9077287 AGGGGAACAGCTTTGGTGACTGG + Intergenic
1154109860 18:11557928-11557950 AGCCAAGCAGCTGTGTGGAGGGG - Intergenic
1155234198 18:23803320-23803342 GGGAACTCAGCTGTGGTGAGTGG + Intronic
1156507425 18:37606992-37607014 AGGCAGAATGCTGTGGTCAGGGG + Intergenic
1156812932 18:41274186-41274208 AGGCAATTAGCTGGGGGGAGAGG + Intergenic
1157204541 18:45687373-45687395 AGGCAGACAGCTGTGGTCAGGGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1160152734 18:76407314-76407336 ACTCGAACAGCTGAGGTGAGAGG + Intronic
1162634925 19:11960429-11960451 GGGCAGAAAGCTGAGGTGAGAGG - Intronic
1164881184 19:31734135-31734157 AGGCAAACTGCAGAGGGGAGAGG - Intergenic
1165854618 19:38871861-38871883 AGGGACACACCTGTGGTGGGGGG + Exonic
1166442914 19:42831610-42831632 AGGCCAACAGCAGTGGAAAGTGG + Intronic
1167179423 19:47891151-47891173 AGGCACAGAGCAGTGGGGAGAGG + Intergenic
1167515813 19:49922582-49922604 AGGATGACAGCTGTGGGGAGGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168547420 19:57264939-57264961 GGGCAAACAGGTATGTTGAGAGG - Intergenic
925160045 2:1677350-1677372 AGCCAAACACCTGTGCGGAGTGG + Intronic
925274849 2:2641429-2641451 AGGCAGACAGCTGTGGAGGTCGG + Intergenic
925381613 2:3431300-3431322 AGGCAGACGGCTGTGCTGTGGGG - Intronic
926907333 2:17817757-17817779 AGGCAAACAGCTTGTGTGACAGG + Intergenic
927210149 2:20634217-20634239 AAGGAAACAGGTGTGGAGAGTGG - Intronic
927290309 2:21398426-21398448 AGGCAAACAGCTCTGGGGAGAGG - Intergenic
928890536 2:36198580-36198602 AGCCAAACACCTCTGATGAGTGG + Intergenic
929535757 2:42783372-42783394 TGGCAAACCTCTGTGGTGAGTGG + Exonic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929720500 2:44362463-44362485 AGGAAAAGAGCAGTGGGGAGCGG - Intronic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931232784 2:60388611-60388633 AGGCCAGCAGCTGAGATGAGAGG - Intergenic
932215452 2:69963199-69963221 AGCCAGGCAGCTGTGATGAGAGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933729678 2:85447225-85447247 AAGCAAACAGCTATGGTAAAGGG - Intergenic
934251650 2:90360334-90360356 AGGCAAAAAGCTACGGTGATGGG + Intergenic
934257906 2:91443064-91443086 AGGCAAAAAGCTACGGTGATGGG - Intergenic
936050388 2:109218044-109218066 TGGCAGACAGCTGCGGGGAGGGG + Intronic
937438392 2:121897479-121897501 AGGCAGGCAGATGAGGTGAGAGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939650543 2:144757115-144757137 ATGCAAACAGGTGGGGGGAGGGG - Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941784744 2:169485034-169485056 AGGCAAACAGAGGTGGTTGGTGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943206315 2:184901523-184901545 AGGCAAACATCTGGGGTCATAGG + Intronic
943736559 2:191362894-191362916 AGTGAGACAGCTGTGGTGATGGG + Intronic
944050578 2:195464041-195464063 ATGCAAACATCTGAGGTGAGGGG + Intergenic
944050651 2:195465237-195465259 ATGCAAACATCTGAGGTGAGGGG - Intergenic
947154293 2:227145830-227145852 ATGAAAACAGCTGAGGAGAGAGG - Intronic
947375324 2:229489598-229489620 AGGCAAAGTGCTGAGGTGAAAGG + Intronic
947746895 2:232512514-232512536 AGGGAAAGAGCTGTGGGCAGGGG + Intergenic
947872212 2:233445574-233445596 AGGCAAACACCTGGGGGCAGGGG - Intronic
948596534 2:239082914-239082936 AGGCACACAGCTGTTCTCAGCGG - Intronic
1170136492 20:13079893-13079915 GGGCAAACAGCTGTGGCAGGTGG - Intronic
1170768050 20:19308472-19308494 AGGCCACCAGCTGAGGGGAGGGG + Intronic
1171170710 20:23012915-23012937 AGGCAGACAGCTGTCTTAAGTGG - Intergenic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172183683 20:33018741-33018763 AGTCAAACAGCTGCTGGGAGAGG - Exonic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173478795 20:43383085-43383107 AGCCAAACAGCTGTGGCTGGAGG - Intergenic
1174072165 20:47906897-47906919 AGGCAAACAGAGATGGGGAGAGG + Intergenic
1174190792 20:48738963-48738985 ATCCATACAGCTGTGGGGAGAGG + Intronic
1175300722 20:57940982-57941004 AGGCAGACAGCAATGCTGAGAGG - Intergenic
1176807855 21:13507683-13507705 AGGTTAATAGATGTGGTGAGTGG + Intergenic
1176963847 21:15189987-15190009 GGGCAGAGAGCTGTGGGGAGAGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177563671 21:22790036-22790058 ATGCAAACTGCTCTGGTGACAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178014167 21:28324001-28324023 AGGAAAAAAGATGTGATGAGAGG - Intergenic
1178582579 21:33848842-33848864 AGGCTAATATCGGTGGTGAGGGG - Intronic
1178944258 21:36933176-36933198 AGCCAATCAGCTGTGGTTTGGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179481255 21:41680065-41680087 AAGCAAGCAGCTGAGGTGGGTGG - Intergenic
1181432053 22:22887776-22887798 AGGCAGCCGGCTGTGGTGGGAGG + Exonic
1185241371 22:49749346-49749368 AGGCACAGAGCTGTGGGGAGGGG + Intergenic
950534167 3:13569757-13569779 TGGCCAGCAGCTGTGGTGCGTGG + Intronic
951178718 3:19633294-19633316 AGGCAAACAGTGATGGAGAGAGG + Intergenic
951193866 3:19803126-19803148 AGGCAAACAGCTGCCATGACAGG + Intergenic
952425903 3:33174266-33174288 AGGAAAGCAGGGGTGGTGAGGGG - Intronic
952851505 3:37733405-37733427 AGGTAAAAAGATGTGGTGATTGG + Intronic
954245172 3:49325711-49325733 AGGCAGACACCATTGGTGAGAGG - Exonic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956707023 3:72007912-72007934 AGGAAAACATCAGTGGTAAGGGG - Intergenic
959623905 3:108428077-108428099 ACACAAACAGCTTTGCTGAGAGG - Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960287605 3:115847163-115847185 AATCAAACAGCTTTGGTGAGTGG - Intronic
961215895 3:125160286-125160308 GGGGAAACAGAGGTGGTGAGAGG - Intronic
961677799 3:128578115-128578137 AGGCAAGCAGCCGTGGTGACAGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
968316259 3:197728238-197728260 ACAAAAACAGCTGTGGGGAGAGG + Intronic
969064534 4:4467871-4467893 AGGCAAAAATGAGTGGTGAGAGG + Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969801721 4:9571810-9571832 GGGCAAACTGCTTTGGTGATGGG + Intergenic
969848227 4:9936358-9936380 AGTCACACAGCTGTGGTATGGGG + Intronic
971750305 4:30638539-30638561 TGTCAAACAGCTGTTGAGAGTGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
978046040 4:104128924-104128946 AGGCAAACAACTGTGGAGGATGG + Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979303619 4:119116127-119116149 AGGAAAACAGTTGTGATGATTGG - Intergenic
979446319 4:120816502-120816524 AGGCTGACAGCTGTGGAAAGAGG - Exonic
979618170 4:122768188-122768210 AGGGAAAAAGCTGGGGGGAGGGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982425138 4:155249281-155249303 AGGCAAAGAACTAGGGTGAGAGG + Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
985102762 4:186474769-186474791 AGGCAAGCAGCTTTGGTCATGGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988618897 5:32802386-32802408 AGGCTAACAGCTGTAGGCAGTGG + Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989283421 5:39671015-39671037 AGGCAAAAAGCTGTTGTGTTAGG - Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990174248 5:53089578-53089600 AAGCAAACAGCTTTGGGGAAGGG - Intronic
990567381 5:57043033-57043055 AGGAAAACAGTCATGGTGAGAGG - Intergenic
991940763 5:71850094-71850116 ATGAAAACAGCTGGGGTGGGGGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992674443 5:79091881-79091903 ACCCAAACAGATGTTGTGAGGGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
997028151 5:130090521-130090543 AAGCAAGCAACAGTGGTGAGAGG - Intronic
997293372 5:132753689-132753711 AGGCTAACACCTGTGATGGGAGG + Exonic
997471608 5:134120429-134120451 AGGCACTCGGCTGTGATGAGTGG - Intronic
997905223 5:137809603-137809625 AGGCAAACAGCAGTGATGGCTGG + Intergenic
998290662 5:140911034-140911056 AAGCAAACAGGGGTGGTGGGGGG + Intronic
998939201 5:147262203-147262225 AGGCAAACAGAAGTGGGGTGAGG - Intronic
999381317 5:151123472-151123494 AGTCAACCTGCTGTGGTTAGAGG - Intronic
1000260713 5:159585785-159585807 AGGCCCAGAGCTGGGGTGAGGGG - Intergenic
1001058630 5:168469789-168469811 AGGGAAACAGATGAAGTGAGGGG - Intronic
1001500323 5:172227226-172227248 CTGCAAACAGCTGAGGTGAGAGG - Intronic
1002197404 5:177508910-177508932 AGGCCAAGAGCTGGGGTGGGAGG + Intronic
1002721680 5:181265221-181265243 AGGCAAAAAGCCGGGGTCAGGGG + Intergenic
1004251221 6:14024623-14024645 TTGCTAACAGCTGTGGTGAGTGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005906059 6:30261985-30262007 AGGAAAGCAGGTGTGGTGACTGG - Intergenic
1006297481 6:33176389-33176411 AGACAAAGGGCTGTGGTCAGGGG - Intronic
1007208015 6:40168373-40168395 AGGTAAAGAGCTGAGGGGAGAGG - Intergenic
1008022552 6:46597157-46597179 AAGCAAACACCTTTGGTTAGTGG + Intronic
1008028247 6:46663328-46663350 GGGCAGACAGCAGTGGTCAGCGG - Intronic
1008276411 6:49549451-49549473 AGGCAAAGAGTAGTGGTCAGCGG + Intergenic
1008370423 6:50724548-50724570 ACGCACCCAGCTGTGGCGAGAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008837229 6:55849160-55849182 AGGCACACTGCTGTGGTCTGGGG + Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1012531565 6:100244225-100244247 AGTGATAGAGCTGTGGTGAGTGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014088376 6:117373503-117373525 AGGCCAGCAGCTGTGGAGAGGGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017137917 6:151164476-151164498 AAGGAAACAGCTCTTGTGAGAGG - Intergenic
1017611229 6:156188550-156188572 AGGGAAACAGCTAAGTTGAGAGG + Intergenic
1018434637 6:163749280-163749302 AGGGGAACAGATGGGGTGAGGGG + Intergenic
1018757535 6:166862868-166862890 AGGAAAGCAGCTGTGCTGCGTGG - Intronic
1019408110 7:894485-894507 GGGCAGACATCTGTGGGGAGAGG - Intronic
1019607386 7:1917027-1917049 AGGAAAACTGCAGTGGGGAGTGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021914249 7:25415492-25415514 ATGAAAAGAGCTGTGGTCAGGGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1023184483 7:37518678-37518700 AGGCCAACATCTGAGGAGAGAGG + Intergenic
1023862647 7:44225463-44225485 AGGCAAGCAGCTGAGGGGAGAGG - Intronic
1024248991 7:47492240-47492262 AAACAGAGAGCTGTGGTGAGGGG - Intronic
1024633108 7:51265286-51265308 AGTTAAATAGCTGTGGAGAGGGG + Intronic
1024896070 7:54263669-54263691 AGACAACCAGCTTTGTTGAGGGG + Intergenic
1025320136 7:58087036-58087058 GGGCAAAAAGCTGTGGTGGCAGG - Intergenic
1025320241 7:58087500-58087522 GGGCAAAAAGCTGCGGTGACGGG - Intergenic
1025553521 7:62276201-62276223 GGGCAAAAAGCTGCGGTGATGGG + Intergenic
1025812505 7:64884149-64884171 AGCAAAAGATCTGTGGTGAGAGG - Intronic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028391580 7:90322455-90322477 TGGAAAACAGCTTTGGTGGGTGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029277892 7:99418432-99418454 GGGCCAACAACTGTGCTGAGGGG - Exonic
1029451282 7:100642875-100642897 GGGCTAACAGTTGTGGTGGGAGG - Intergenic
1029877691 7:103771330-103771352 AGGCAAGCCTCTGAGGTGAGGGG - Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031447697 7:121873924-121873946 AGAAATACAGCTGTGGTGCGGGG + Intronic
1032478020 7:132225617-132225639 AGGCAGAAAGCTGTGGGGGGGGG - Intronic
1032478739 7:132229785-132229807 AAGCAGACAGGTGTGGTGTGGGG + Intronic
1033531538 7:142269099-142269121 AGGGAACCAGCTCTGGTGACAGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034922171 7:155092431-155092453 AGGCAAACAGCCGAGTGGAGGGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035337358 7:158138458-158138480 AGGCAGCCGGCTGAGGTGAGGGG - Exonic
1036762959 8:11524718-11524740 ATGGAAACAGCTGGGGTGTGCGG + Intronic
1038488207 8:27951271-27951293 AGGACAAGAGCTGTGCTGAGTGG + Intronic
1039255250 8:35711523-35711545 AGGAATACAGCAATGGTGAGAGG - Intronic
1039272389 8:35897292-35897314 AGGCAAAGAGCTGTGGTGCTTGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040010825 8:42659750-42659772 AGGCAAGCAGCTGAGATGACAGG - Intergenic
1040392721 8:46963357-46963379 ACACAAGCAGCTGAGGTGAGAGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045282192 8:100758766-100758788 AGGCAGCCAGCTGGGGTGGGAGG - Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046328634 8:112682798-112682820 AGGCAAACAGGTAAGGTCAGAGG - Intronic
1047899597 8:129405712-129405734 AGGCAAAGAGGTGTGTTCAGGGG + Intergenic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049585527 8:143430887-143430909 CGGGAAACAGCTGTGGGAAGAGG + Intergenic
1051109000 9:13613993-13614015 AGGTAAACAGCTTTGGTCAAAGG - Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053180092 9:35961248-35961270 GGGAGAACAGCTGAGGTGAGGGG - Intergenic
1055100575 9:72460514-72460536 AGGCAAGCAGCTGTGGGCAACGG - Intergenic
1055467678 9:76581953-76581975 AAACAAGCAGCTGTGGGGAGAGG + Intergenic
1056215779 9:84404734-84404756 AGGAACACAGCTGGGGTCAGGGG - Intergenic
1056241029 9:84646898-84646920 AGCCAGTCAGCTTTGGTGAGGGG + Intergenic
1056667025 9:88589249-88589271 AGGCAACCAGCTGTGGGCAAGGG + Intergenic
1057694793 9:97315482-97315504 AGGAAAGCAGCTGTGGGGAGGGG - Intronic
1059771554 9:117431225-117431247 AGGCAGACAGCTTTGGAGACAGG + Intergenic
1059935518 9:119306462-119306484 AGGCTGACAGCATTGGTGAGAGG - Intronic
1060527255 9:124327605-124327627 AGGGAATCAGCTGTGGCCAGAGG + Intronic
1060714288 9:125908248-125908270 AGGGAAGCAGCTGTGTGGAGAGG + Intronic
1061267166 9:129513515-129513537 TGGAAAGCAGCTGGGGTGAGTGG - Intergenic
1061609466 9:131736835-131736857 AGGCAAACAATTGTTGTGATTGG - Intronic
1185573299 X:1151270-1151292 AGGGAGACATCAGTGGTGAGAGG - Intergenic
1189849179 X:45162124-45162146 AGGAACCCAGCTGTGGTGAGTGG - Intronic
1190118532 X:47641481-47641503 GAGCAAACAGCTGAGTTGAGAGG + Intronic
1190376985 X:49797623-49797645 AGGCAATCAGCTTTGGTATGAGG + Intergenic
1190407896 X:50105754-50105776 AGGCAGACAGCTGTGAGAAGAGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191887263 X:65901464-65901486 AGGCAAGTAGCAGTGGTGATGGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194001908 X:88440218-88440240 GGAAAAACAGCTGTGTTGAGTGG - Intergenic
1194520249 X:94909520-94909542 AGCCCAAGAGCTCTGGTGAGGGG - Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195329927 X:103788496-103788518 TGCAAAACAGCTGAGGTGAGTGG + Exonic
1195354439 X:104025432-104025454 AGGCAAACAGCTCTGAAAAGAGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199280278 X:145992894-145992916 AGGCAGCCTGCTGTGTTGAGGGG - Intergenic
1199280467 X:145994419-145994441 AGGCATCCTGCTGTGTTGAGTGG - Intergenic
1199892233 X:152097230-152097252 AGGCAAACAGATGTATTGAAAGG + Intergenic
1200922551 Y:8626285-8626307 AGCCAAAGATGTGTGGTGAGAGG - Intergenic