ID: 1079786676

View in Genome Browser
Species Human (GRCh38)
Location 11:24681897-24681919
Sequence CCCCATGCTAACAGGTACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079786673_1079786676 14 Left 1079786673 11:24681860-24681882 CCAGGAATAAATTGCATTTTTGA 0: 1
1: 0
2: 2
3: 60
4: 859
Right 1079786676 11:24681897-24681919 CCCCATGCTAACAGGTACTTTGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079786676 Original CRISPR CCCCATGCTAACAGGTACTT TGG Intronic
907059873 1:51410633-51410655 CCTCCTGCTGACAGATACTTCGG - Intronic
910390570 1:86738956-86738978 CCCCATTCTTTCAGTTACTTAGG - Intronic
912154403 1:106899659-106899681 CCCCAGGCAAACATATACTTTGG - Intergenic
912434685 1:109653131-109653153 GCCCATCATACCAGGTACTTGGG - Intergenic
914684823 1:149969196-149969218 GCCCATGCTCCCAGCTACTTGGG + Intronic
923633449 1:235671237-235671259 CTCCATAAAAACAGGTACTTTGG - Intronic
1063390516 10:5647364-5647386 CCCTGTGCTAACAGTCACTTTGG + Intronic
1073485069 10:103812115-103812137 CCGCATGCTCTCAGGTACTCTGG - Intronic
1074889521 10:117723738-117723760 CCCAAAGCTAACAGGTACTAGGG - Intergenic
1076066751 10:127454491-127454513 CCCCCTGAAAACTGGTACTTGGG - Intergenic
1077097750 11:806245-806267 GCCCAGGAGAACAGGTACTTAGG + Intronic
1079786676 11:24681897-24681919 CCCCATGCTAACAGGTACTTTGG + Intronic
1081124381 11:39304794-39304816 CCCCAGGGTAGCAGGGACTTTGG - Intergenic
1083816361 11:65134528-65134550 CCCCCTGCGAACCGGAACTTCGG + Exonic
1083840431 11:65301389-65301411 CTACATGCTACCAGGTACTGAGG - Intronic
1084256218 11:67944707-67944729 GCCCCTGCTAACAGGGACTCTGG - Intergenic
1085041591 11:73329757-73329779 CCACATATTAACAGGTATTTAGG + Intronic
1086229357 11:84549703-84549725 CCGCCTCCTAACAGGTGCTTAGG + Intronic
1087014171 11:93540232-93540254 TCCCTTGCACACAGGTACTTGGG - Intronic
1092426450 12:8379438-8379460 ACCCCTGCTAACAGGGACTCTGG - Intergenic
1098521848 12:71441210-71441232 CCCGAAGGTAACAGGTAGTTGGG + Intronic
1102139953 12:110606472-110606494 TCCCATGCTCACGGGCACTTAGG - Intergenic
1102493445 12:113303313-113303335 CCACAAGCAAACAGCTACTTAGG - Intronic
1103639979 12:122342702-122342724 GCCTGTGGTAACAGGTACTTGGG + Intronic
1104287417 12:127437094-127437116 CCCCATGCTCACAGCCTCTTGGG + Intergenic
1105743152 13:23350002-23350024 CCCCACACTAACACGTATTTAGG + Intronic
1107119840 13:36784570-36784592 GCCCATGCTAACATGAAATTAGG - Intergenic
1108531125 13:51328468-51328490 CCCCCTGCTCACAGGGCCTTAGG + Intergenic
1109679417 13:65730176-65730198 GCCAATGCTACCAGGTATTTCGG - Intergenic
1112116920 13:96366346-96366368 ACCCATGCTCCCAGCTACTTGGG + Intronic
1112782367 13:102914982-102915004 GCCCATGAGACCAGGTACTTTGG + Intergenic
1127003118 15:54533601-54533623 CTCCATGGTATCAGGGACTTCGG - Intronic
1133371845 16:5251135-5251157 GCCCCTGCTAACAGGGACTCTGG + Intergenic
1134655359 16:15944158-15944180 CCCCATAGTCACAGCTACTTGGG + Intergenic
1138180533 16:54937703-54937725 CCCAATGCTAACTGGGTCTTAGG - Intergenic
1142916422 17:3142858-3142880 GCCCATGCCACCAGGTCCTTGGG - Intergenic
1143871480 17:9959879-9959901 CCCCAGGCTCAGAGGTACTTGGG - Intronic
1145921240 17:28611723-28611745 CCCCAGGATGAGAGGTACTTTGG - Intronic
1150580091 17:66465296-66465318 CCCGATGCTATCAGTTTCTTAGG - Intronic
1151251430 17:72838643-72838665 CCCCACGCTCACTGGTAGTTAGG - Intronic
1153580406 18:6567772-6567794 CCCCATACCAACAAATACTTTGG - Intronic
1153592545 18:6688788-6688810 TCCCATTCTAATAGGTACGTAGG - Intergenic
1156694695 18:39753011-39753033 CCCCATGTTACCAAGGACTTGGG + Intergenic
1158106196 18:53887908-53887930 CCCAATACTGACAGGTCCTTTGG - Intergenic
1158547745 18:58410400-58410422 CCCCACGCTTTCAGGTGCTTCGG - Intergenic
1162073421 19:8168719-8168741 CCCCATGGTCCCAGCTACTTGGG - Intronic
1162962379 19:14135947-14135969 CCCCATGAAAACGGGTACCTAGG + Intronic
1165773702 19:38392677-38392699 CCCCATGCTTCCAGTTACTCAGG + Intronic
1168280299 19:55302158-55302180 CCCCATACTCACAGGTACCAAGG - Exonic
931003754 2:57823138-57823160 CACCATGCTAATAGGTACATAGG - Intergenic
934849739 2:97690503-97690525 CCCCATAGTCACAGCTACTTGGG - Intergenic
934915408 2:98297617-98297639 CCCCATCCTGACAGGAACATGGG - Intronic
935165395 2:100564733-100564755 CACCATGCAAACCGGTGCTTGGG + Intronic
944793255 2:203155121-203155143 GCCCATGATCCCAGGTACTTGGG + Intronic
947529648 2:230900727-230900749 CCCCATGCTAACACCCACTCTGG - Intergenic
1169227296 20:3864712-3864734 CACCATGCTAGTAGGCACTTTGG - Exonic
1170342170 20:15341422-15341444 CCCCATGATAACATGTATTTAGG + Intronic
1175898008 20:62348019-62348041 GCCCTTGCTTATAGGTACTTGGG - Intronic
1179916435 21:44480962-44480984 CCTCATGCTCACAGGTTCTCTGG + Intergenic
1181985690 22:26798677-26798699 GCCCATTCTAACAGTGACTTAGG + Intergenic
1183013865 22:34970052-34970074 CCACATGCTAAGGGCTACTTTGG + Intergenic
950929767 3:16776795-16776817 CCCCATGATGACAGGCACTCAGG + Intergenic
953372991 3:42406035-42406057 CCCCTTAATCACAGGTACTTGGG + Intronic
955801118 3:62687551-62687573 CCCCAGGGTACCAGGGACTTAGG + Intronic
956970898 3:74524159-74524181 CCCCAAGATAACATGTACATTGG + Intergenic
957373129 3:79322194-79322216 CCCCTTGGTATCAGGTACTATGG + Intronic
958606473 3:96364544-96364566 CCCCAGGCAAACTGGTTCTTGGG - Intergenic
961282982 3:125777980-125778002 GCCCCTGCTAACAGGGACTCTGG + Intergenic
963531327 3:146476415-146476437 GCCCATGCTACCAGGGCCTTGGG + Intronic
964777368 3:160292943-160292965 ACCCATCCTATCAGGTCCTTAGG - Intronic
969014733 4:4096441-4096463 CCCCCTGCTAACAGGGACTCTGG - Intergenic
973834472 4:54795600-54795622 CCCCATGGTAAGAACTACTTTGG + Intergenic
976508433 4:85878712-85878734 CTCTATGATAACAAGTACTTTGG - Intronic
979567355 4:122169781-122169803 CCTCCTGCTATCAGATACTTAGG - Intronic
982857879 4:160408130-160408152 TCCCATGCGACTAGGTACTTAGG + Intergenic
983774964 4:171595078-171595100 GCCCATGCCAGCAGGGACTTGGG - Intergenic
984749155 4:183255000-183255022 CCCCATGCTAACACCTACCTGGG - Intronic
984806041 4:183752812-183752834 CCCCATGCTCTCTGGTTCTTGGG + Intergenic
991637683 5:68722732-68722754 CCCCATGAGAACAAGTACATAGG - Intergenic
991975820 5:72182992-72183014 CCCCCTGCTCACAGGTCCTAGGG - Intronic
1001691031 5:173632632-173632654 CCCCATGGGAACAGGGAATTAGG - Intergenic
1003856812 6:10284814-10284836 GCCCAGGGTCACAGGTACTTCGG + Intergenic
1006192753 6:32219754-32219776 CGCCATGTTCACAGGGACTTGGG + Exonic
1008739668 6:54590608-54590630 CCCTATCCTCACAGGTACGTAGG - Intergenic
1009939846 6:70278822-70278844 CCCCACTCTAACAGAAACTTTGG - Intronic
1011915968 6:92507846-92507868 GCCCATGCCACCAGGTCCTTGGG + Intergenic
1017244688 6:152210027-152210049 CCTCATGCTGGCAGGTAGTTTGG - Intronic
1022537249 7:31105929-31105951 CACCATGCTAAGAGCTACATGGG + Intronic
1024883324 7:54114053-54114075 CCCCATGCTAGCAGGTGGTGAGG - Intergenic
1025076309 7:55946523-55946545 CTCCATGCTAACAAGCTCTTTGG - Intergenic
1026224667 7:68429748-68429770 CCCCAGGATAACAGGTTCCTGGG + Intergenic
1026735811 7:72947971-72947993 TCCAATCCTAACAGGTATTTAGG - Intronic
1026786154 7:73302902-73302924 TCCAATCCTAACAGGTATTTAGG - Intronic
1027107923 7:75417092-75417114 TCCAATCCTAACAGGTATTTAGG + Exonic
1029073406 7:97918071-97918093 GCCCCTGCTAACAGGGACTCTGG - Intergenic
1033664331 7:143426376-143426398 CCCCCCTCTAAAAGGTACTTAGG - Intergenic
1034447697 7:151122022-151122044 CCCCATGCGGACAGGAACTGGGG - Intronic
1034506769 7:151498500-151498522 GCCCATGCTCCCAGGTACTTGGG + Intronic
1035750954 8:1995898-1995920 CCCCATAGTCACAGCTACTTGGG + Intronic
1036244282 8:7103219-7103241 GCCCCTGCTAACAGGTATTCAGG + Intergenic
1036256460 8:7210520-7210542 GCCCCTGCTAACAGGGACTCTGG - Intergenic
1036308510 8:7669105-7669127 GCCCCTGCTAACAGGGACTCTGG - Intergenic
1036361024 8:8076972-8076994 GCCCCTGCTAACAGGGACTCTGG + Intergenic
1036897550 8:12648190-12648212 GCCCCTGCTAACAGGGACTCTGG - Intergenic
1039562374 8:38523001-38523023 CCCCAGGCTCCCAAGTACTTGGG + Intronic
1047227795 8:122971146-122971168 CCCCATGCTAAGTGGTAATACGG - Intronic
1048613293 8:136047699-136047721 CACAGTGCTAACAGGAACTTGGG - Intergenic
1050925346 9:11256914-11256936 CCCCATGTTAACAGTTCATTTGG + Intergenic
1053023051 9:34708987-34709009 ACACATGGGAACAGGTACTTGGG + Exonic
1060826601 9:126691546-126691568 CCACATGCTCACATGTACTGTGG + Intronic
1187305036 X:18087417-18087439 CCTCATGGTCTCAGGTACTTGGG + Intergenic
1188669700 X:32868243-32868265 GCCCATGCCAACAGGGCCTTGGG + Intronic
1192631433 X:72780756-72780778 CACAGTCCTAACAGGTACTTAGG + Intronic
1192650276 X:72940045-72940067 CACAGTCCTAACAGGTACTTAGG - Intronic
1193494715 X:82197086-82197108 TGGCATGCTAACAGGTACTGTGG + Intergenic
1195057932 X:101164631-101164653 CTCCATAAAAACAGGTACTTTGG - Intergenic
1195134040 X:101885806-101885828 ACCCATGGTCACAGCTACTTGGG - Intronic
1197180726 X:123533490-123533512 GCCCATGCTACCAGGGCCTTGGG - Intergenic