ID: 1079787231

View in Genome Browser
Species Human (GRCh38)
Location 11:24688927-24688949
Sequence ACAGTGAGACAATACAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079787231_1079787235 -3 Left 1079787231 11:24688927-24688949 CCCTCCCTGTATTGTCTCACTGT 0: 1
1: 0
2: 2
3: 28
4: 279
Right 1079787235 11:24688947-24688969 TGTAGTCAACATACTACCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079787231 Original CRISPR ACAGTGAGACAATACAGGGA GGG (reversed) Intronic
900418537 1:2545935-2545957 ACAGGGAGACAGGCCAGGGAAGG - Intergenic
902093983 1:13927343-13927365 ACAGTGGGGCATTACAGAGAGGG + Intergenic
903348598 1:22703982-22704004 ACAGTGAGACAAGACTGGGAAGG + Intergenic
904361957 1:29981823-29981845 ACAGTGAGGCTATAGAGTGAGGG - Intergenic
905297511 1:36963488-36963510 TCAGTGAGATAATGCATGGAAGG - Intronic
905851936 1:41281072-41281094 ACACTGTGAGAAGACAGGGAAGG - Intergenic
906570179 1:46831145-46831167 ACAGTGAGCCAAAGCAGGGCGGG - Intergenic
906775070 1:48521750-48521772 ACAGAGAGAAAAAACAGGAAGGG - Intergenic
907028897 1:51151538-51151560 ACAGTAAGACTGTAGAGGGAAGG + Intergenic
908596044 1:65689881-65689903 ACAGGGAGCCCATAGAGGGAAGG - Intergenic
910951756 1:92655711-92655733 ACAGTGAAAAAAGACAAGGAAGG + Intronic
913353069 1:117884340-117884362 ACAGAGATACAATATAGGCAGGG + Intronic
914322809 1:146581621-146581643 ACAGTCAGGCCAAACAGGGATGG - Intergenic
914804913 1:150984674-150984696 ACAGTAAGAATATAGAGGGAGGG + Exonic
914938756 1:152003677-152003699 ACAGTGAAATCATAGAGGGAGGG + Intergenic
915331879 1:155117745-155117767 ACAGGGAGACAGTGCAGAGAGGG - Intergenic
915819408 1:159005944-159005966 ACAGTGAGAAGAAACAAGGAAGG - Intronic
917954993 1:180086131-180086153 ACAGGTACACAATACAGAGATGG + Intronic
919927250 1:202198703-202198725 ACAGTCTGAAAATCCAGGGAGGG + Intronic
920549900 1:206850160-206850182 ACAGAGTGAAAATAAAGGGATGG + Intergenic
920606887 1:207397696-207397718 ACTGTGACACATTCCAGGGAAGG - Intergenic
921073754 1:211683729-211683751 ACAGTGGGACAAGATAGTGAGGG + Intergenic
924630202 1:245730568-245730590 ACAGATAGAAAATAAAGGGATGG + Intergenic
1063089575 10:2850445-2850467 GCACTGATACAATACAGGAAGGG + Intergenic
1064128249 10:12683534-12683556 ACAGTGAAAAAAGACAGGAAGGG - Intronic
1065593707 10:27291722-27291744 AGAGTGAGTTAATACAGGGAGGG + Intergenic
1065656646 10:27958541-27958563 AGAGTGAGTTAATACAGGGAGGG - Intronic
1069513223 10:69057438-69057460 CCAGGGAGACAATAAGGGGAAGG - Intergenic
1069646726 10:70005089-70005111 AGAGTGAGACAAGAAAGGAAAGG + Intergenic
1069846951 10:71378828-71378850 GAAGTGAGACAAGAAAGGGAAGG - Intergenic
1070975497 10:80603063-80603085 TTAGTGAGATAATGCAGGGAAGG + Intronic
1071339616 10:84632290-84632312 CCAGTGGGACAAGACATGGAGGG + Intergenic
1073673871 10:105623118-105623140 ACAGTGAGAACACACAGAGAGGG + Intergenic
1073876104 10:107922867-107922889 ACAGTGTCAAAATAAAGGGATGG + Intergenic
1074094856 10:110302554-110302576 GCAGTGGGATAATAAAGGGAGGG + Intronic
1074863024 10:117527337-117527359 ACAGTAAGACATTACAAGGAGGG - Intergenic
1075026437 10:118987788-118987810 ACAGTGAGACTATGGAAGGAAGG + Intergenic
1075816006 10:125265283-125265305 AAAGAGAGAGAATCCAGGGAGGG + Intergenic
1077290958 11:1792616-1792638 AAAGTGAGACAGTACAAGGACGG + Intergenic
1077988225 11:7376810-7376832 TCAGAGAGAGCATACAGGGATGG + Intronic
1078585431 11:12582639-12582661 AGAGTAAGACAAGACAGGGCCGG + Intergenic
1079787231 11:24688927-24688949 ACAGTGAGACAATACAGGGAGGG - Intronic
1080550492 11:33370406-33370428 ACAGTGAGACAAGAAATTGAGGG + Intergenic
1080660522 11:34292632-34292654 ACAATAAGAAAATACAGGTATGG + Intronic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1082060078 11:47852447-47852469 ATAGTGAGACTATATAGAGAGGG - Intergenic
1083909838 11:65700032-65700054 ACAGTGAGACAACAGAGAGATGG - Intergenic
1084971948 11:72776886-72776908 ACAGTGAGACAGGGCTGGGAGGG + Intronic
1085336188 11:75698285-75698307 ACAGTGGGAGACTACAGGGGAGG - Intergenic
1088920399 11:114256782-114256804 ACAGGGAGATGAGACAGGGAGGG - Intergenic
1089496505 11:118910883-118910905 ACAGGGAGACAAGACACGCACGG + Exonic
1089774858 11:120829008-120829030 TCAGTGGGACGAGACAGGGAAGG - Intronic
1090465451 11:126929326-126929348 ACAGGGAGTCAAGACAGGGAAGG + Intronic
1092685578 12:11041238-11041260 ACAGAGAGAAAATAAAGGGATGG + Intronic
1092693523 12:11143616-11143638 ACAGATAGAAAATAAAGGGATGG + Intronic
1092764376 12:11839399-11839421 ACAGTGAGTCATCACAAGGAAGG + Intronic
1093307691 12:17540284-17540306 AGAGTGAGACTAGACAGGTAAGG + Intergenic
1094023845 12:25941978-25942000 ACAGTTAAATAATATAGGGAGGG - Intergenic
1094375997 12:29787746-29787768 ACAGAGAGACACTTTAGGGATGG - Intergenic
1096400659 12:51303562-51303584 AAAGTGAGACAAGTCAGAGAAGG - Intronic
1096895753 12:54819386-54819408 ACAGTGAGCCAAAGCAGGGTGGG - Intergenic
1097661337 12:62434887-62434909 GCAGAGTGACAATACAGGAAGGG + Intergenic
1099094816 12:78361064-78361086 AAAGTGAGAAAATACCTGGATGG - Intergenic
1099888633 12:88562465-88562487 TCAGTCTGACAAAACAGGGAGGG - Intronic
1101194023 12:102364252-102364274 ACACAAAGACAAAACAGGGATGG + Intergenic
1101262323 12:103045709-103045731 ACAGGGAGACAATGCATGCATGG - Intergenic
1101377421 12:104183313-104183335 ACTGTGAGACAATACGTGGGTGG - Intergenic
1101405696 12:104426681-104426703 ACAGAGTGAAAATAAAGGGAAGG + Intergenic
1102263589 12:111461597-111461619 ACAGTGACACAAAGCAGGGTAGG + Intronic
1102897228 12:116608106-116608128 AAAGTGACACAAAAGAGGGAGGG + Intergenic
1103450670 12:121026468-121026490 ACAGTGAGACAGATAAGGGAAGG + Intronic
1104400619 12:128472985-128473007 ACTGTGAGACACTACAGGGTTGG + Intronic
1107279366 13:38716101-38716123 CCAGTGAGACAGGACATGGAAGG - Intronic
1107337135 13:39367209-39367231 AGAGTGAGGCAAAACAGAGAGGG + Intronic
1107753494 13:43594594-43594616 TCAGTGAGATAATAAAGGGAGGG - Intronic
1108633869 13:52313484-52313506 ACAGTGAGACGATAAAGAAATGG + Intergenic
1108634290 13:52317182-52317204 ACAGTGAGACGATAAAGAAATGG + Intergenic
1108803285 13:54126579-54126601 GCAGGGAGACCATACAGGGAGGG - Intergenic
1110685162 13:78363729-78363751 ACTGTGAGCTAATACATGGATGG + Intergenic
1110718611 13:78736276-78736298 ACCATGAGACAACACAGAGAAGG - Intergenic
1110884313 13:80614132-80614154 ACAGGGAGACATCACAGGAAAGG - Intergenic
1113436391 13:110295291-110295313 ACAGAGACACAATAAAGGAATGG + Intronic
1115546003 14:34465264-34465286 AAAGGAAGCCAATACAGGGAAGG + Intergenic
1115751582 14:36498764-36498786 ACAGTGAGACTATATGGTGATGG - Intronic
1116053782 14:39838352-39838374 ACAGTAAGTCAACAGAGGGAAGG - Intergenic
1116529737 14:45955291-45955313 GAAGAGAGACAATAAAGGGAAGG - Intergenic
1116834800 14:49759689-49759711 ACAGTCTGAAAATAAAGGGATGG - Intergenic
1118382269 14:65227315-65227337 ACAGTGAGAGATTACAGGGTAGG + Intergenic
1118819916 14:69338556-69338578 CCAGTGAGACACCAAAGGGAAGG + Intronic
1119615272 14:76094950-76094972 ACAGAAACACAAAACAGGGACGG - Intergenic
1120076240 14:80161866-80161888 ACATTGCCACAATACAGGGCGGG - Intergenic
1121078350 14:91087951-91087973 ACAATGAGACAGCCCAGGGATGG + Intronic
1121798138 14:96752597-96752619 ACAGTGAAACAAAACAGTGTTGG - Intergenic
1124847058 15:33301389-33301411 AAAGTGAGACAGGAAAGGGAAGG - Intergenic
1124930111 15:34111592-34111614 ACACAGAGACTATACAAGGAGGG - Intergenic
1125326272 15:38538773-38538795 ACAGAGAGATAATCCAGAGATGG + Intronic
1126118409 15:45229571-45229593 TCAGTGAGATAATGCATGGAAGG + Intergenic
1126853577 15:52815540-52815562 ACAGTGGCACAAGACAGGAATGG + Intergenic
1127662262 15:61111100-61111122 ATAGTGAGACAATAAAATGAAGG + Intronic
1127804801 15:62509646-62509668 TCAGTGAGACGTTACAAGGAGGG - Intronic
1128214387 15:65924281-65924303 AAACTGAGACATTACAGGGAGGG - Intronic
1130792082 15:87166122-87166144 AGAGTGAGAAAGTACACGGATGG - Intergenic
1130933244 15:88447769-88447791 GCTGGGTGACAATACAGGGAGGG + Intergenic
1131431344 15:92391809-92391831 ACAGTGAGCCACTAGAGGGCAGG + Intergenic
1133686484 16:8170137-8170159 ACCGTGAGAACATAGAGGGAGGG + Intergenic
1133705664 16:8352451-8352473 ACATTGAGACAGTACAGGCTGGG + Intergenic
1136059680 16:27717987-27718009 GAAGTGAGACAAGGCAGGGAAGG - Intronic
1137704297 16:50523565-50523587 AGAGGGAGACAATCCAAGGAAGG + Intergenic
1139384176 16:66553588-66553610 ACAGAGAAACCTTACAGGGAAGG + Intronic
1140010752 16:71129229-71129251 ACAGTCAGGCCAAACAGGGATGG + Intronic
1140119938 16:72074893-72074915 ACAGCCAGGCAGTACAGGGAGGG - Intronic
1141033216 16:80607351-80607373 ACAGGGAGACAAGGAAGGGAGGG + Intronic
1141846000 16:86609611-86609633 AAAGTGAGTCAATTTAGGGAAGG + Intergenic
1142814373 17:2413803-2413825 GCAGTGATACAACACGGGGAAGG - Intronic
1143809900 17:9462805-9462827 AAAGTGAAACTGTACAGGGAAGG + Intronic
1144009233 17:11130225-11130247 ACTGTGAGACAAAATAGGAAGGG + Intergenic
1146438137 17:32870463-32870485 ACAGAGAAAGAATACAGGGGTGG + Intronic
1146465686 17:33084393-33084415 ACAGGGAGCTAATCCAGGGAGGG - Intronic
1146571148 17:33954378-33954400 GCAGTGAGCAAAAACAGGGAGGG - Intronic
1146840070 17:36145497-36145519 ACTGTGTGACTGTACAGGGAGGG + Intergenic
1148706220 17:49635293-49635315 ACAGGCAGACAAAATAGGGAAGG + Intronic
1149070561 17:52537034-52537056 AGAGAGAGACAATAAAGGAAAGG + Intergenic
1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG + Intronic
1151758717 17:76088932-76088954 GCAGGGAGACAGTTCAGGGAAGG + Intronic
1152894120 17:82900804-82900826 ACAGTGAGAAAATACACTCAAGG - Intronic
1154064538 18:11094859-11094881 CCAGTGAGACACCACAGGGATGG + Intronic
1155846561 18:30715442-30715464 CCAGTGAGACAAGATATGGAGGG - Intergenic
1155878224 18:31112617-31112639 AAACTGAGAGAATAGAGGGAGGG - Intergenic
1156581200 18:38377840-38377862 AAAGTAAGAGAATACAAGGATGG + Intergenic
1157924566 18:51749253-51749275 ACAGTGAGACAGTACAGACATGG + Intergenic
1158217187 18:55112429-55112451 ACGAGGAGGCAATACAGGGAAGG - Intergenic
1158284688 18:55866815-55866837 AAAATGAGATAATACAGGGTTGG - Intergenic
1158992668 18:62885911-62885933 AAACTAAGAAAATACAGGGATGG + Intronic
1159077344 18:63696186-63696208 ACAGTTAGACAATGAATGGAAGG - Intronic
1159280820 18:66282726-66282748 TAAGTCAGATAATACAGGGAAGG - Intergenic
1163099571 19:15086338-15086360 ACAGGGAGAGAACACAGGAAAGG + Intergenic
1163186218 19:15641286-15641308 ACAGTAAGAGTAAACAGGGATGG - Intronic
1166194302 19:41196001-41196023 GCAGTAAGACAATAGAGGGAGGG + Intronic
1167386362 19:49166318-49166340 AAAGAGAGCCAAGACAGGGATGG - Intronic
925186522 2:1850247-1850269 AAAGAGAGAAAAGACAGGGAAGG - Intronic
925647156 2:6047192-6047214 ACAGGGTGAAAATAAAGGGAGGG + Intergenic
928963955 2:36958208-36958230 ACTGTGAGACTAGACAGGCACGG - Intronic
929243678 2:39678535-39678557 ACAGAGACAGAAAACAGGGAGGG + Intronic
930013126 2:46952953-46952975 AGAATGAGACAATACTGGCATGG - Intronic
930483686 2:51984627-51984649 ACAGTGATAGAAAAGAGGGATGG - Intergenic
932127562 2:69157584-69157606 AAAGTGAGATAAGACAAGGAGGG - Intronic
932755547 2:74406439-74406461 AAAGTGAGAGAATTCAGGGCAGG - Intergenic
932918460 2:75882555-75882577 AAGGTGTGACAATAAAGGGATGG - Intergenic
933246417 2:79979690-79979712 AAAGTGAGAAAATCCAGGAATGG + Intronic
933558605 2:83863637-83863659 AGAATGAGACAAAACATGGATGG + Intergenic
933567849 2:83972888-83972910 CCAGTGAGACCACACAGGGTGGG + Intergenic
934047644 2:88185843-88185865 ACAATGAGAGAATAGAGAGATGG - Intronic
934704845 2:96470247-96470269 ACAGTGAGACAATTCAGGAAGGG - Intergenic
935343020 2:102074760-102074782 AAAGTAAAACAATACAGGAAGGG + Intronic
936149035 2:110001455-110001477 AGAGAGAGAGAAAACAGGGAGGG + Intergenic
936195646 2:110369915-110369937 AGAGAGAGAGAAAACAGGGAGGG - Intergenic
936652985 2:114451126-114451148 ACAGAGAGACAATGCAAGGCAGG + Intronic
938316054 2:130328823-130328845 ACAGTGAGCCATTATGGGGAGGG - Intergenic
939047807 2:137270155-137270177 AGTGTGAGGCAATACAGAGATGG + Intronic
939141088 2:138355408-138355430 ACAGGGAGAGAATTCAAGGAAGG - Intergenic
940252646 2:151696436-151696458 ACAGTGAAACAATTCTGTGAAGG - Intronic
940766741 2:157797922-157797944 ACCATGAGACAACACAGAGAAGG + Intronic
941244230 2:163077360-163077382 ACAGTGAGACAAAAAGAGGAAGG + Intergenic
941371667 2:164672947-164672969 GCAGTTACACAATGCAGGGAGGG - Intronic
943117251 2:183689172-183689194 ACAGTCTGAAAATAAAGGGATGG - Intergenic
943212717 2:184988788-184988810 ACAATAAAACAATACATGGAAGG - Intergenic
943638113 2:190328000-190328022 ACAGTGGCACAATAGAGGTAGGG + Intronic
944603192 2:201324244-201324266 ACAGTAAGACAAGACAAAGATGG + Intronic
945270375 2:207932579-207932601 ACAGTGAGCCACTTGAGGGAAGG - Intronic
945630010 2:212262757-212262779 ACAGAGAGAAAATAAAGAGAAGG - Intronic
945864137 2:215158128-215158150 ACAGTGAAAGAAAACAGGTAGGG - Intergenic
947803135 2:232944536-232944558 TCAGTGAGAGAAGCCAGGGATGG + Intronic
1170896891 20:20423041-20423063 GCAGGGAGACAATGCAGGGGAGG + Intronic
1171471816 20:25378209-25378231 GCAAAGAGAAAATACAGGGATGG - Intronic
1172431175 20:34893215-34893237 AGAGTGAGACAAACAAGGGAAGG - Intronic
1173539349 20:43839714-43839736 AAAGAGAGAAAATACAGAGATGG - Intergenic
1173823746 20:46034453-46034475 ACCGTGTGCCAATACAGGCATGG - Intronic
1174520110 20:51122786-51122808 GCAAGAAGACAATACAGGGAAGG + Intergenic
1176552491 21:8232984-8233006 ACAGAGAGAACAGACAGGGAGGG - Intergenic
1177091746 21:16778237-16778259 ACAGAGAGACAAGACAAGGGAGG - Intergenic
1183097996 22:35565790-35565812 ACAGGGAGGCAATGCAGGGCTGG + Intergenic
1183145799 22:35990414-35990436 AAAGGGAGAGAATACAGAGAGGG + Intronic
1184228885 22:43147362-43147384 GAAGTGAGAAAATAGAGGGAAGG + Intergenic
1185050363 22:48551104-48551126 TCACTGAGACACCACAGGGAGGG - Intronic
950427317 3:12931467-12931489 TCAGTGAGACAATAGGCGGAAGG + Intronic
950798108 3:15527556-15527578 ACAGTGACATAAAACAGGCAGGG - Intergenic
951207876 3:19943486-19943508 ACACTGACACAAAATAGGGAGGG - Intronic
952610926 3:35207516-35207538 ATACTGAGACATTACAAGGAAGG - Intergenic
952934582 3:38386211-38386233 ACACAGAGACAACACAGGTAAGG - Intronic
953158240 3:40394557-40394579 AAAGTGAGAAAATACAGGTTTGG + Intronic
953472764 3:43180966-43180988 AAAATGAGACAATACAGGCAAGG + Intergenic
953688774 3:45099579-45099601 ACAGAGAAAAAATAGAGGGAAGG - Intronic
956608500 3:71097702-71097724 CCACTGACACAATCCAGGGAGGG + Intronic
956741358 3:72278799-72278821 ACAGGGAGACACCAAAGGGAAGG + Intergenic
958272082 3:91513293-91513315 AAAGTTAGAAAATACAGGAAAGG - Intergenic
959615137 3:108338813-108338835 AGAATGAGATAAAACAGGGAGGG + Intronic
961794881 3:129402378-129402400 GCAGTGACACAACACAGAGAGGG - Intronic
964953713 3:162326673-162326695 ACAGTTAAATAATACAGGAAAGG + Intergenic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
965706723 3:171515960-171515982 AGTGTCAGACAGTACAGGGATGG + Intergenic
967321713 3:188201204-188201226 ACTGGGAGCCAATACTGGGAAGG + Intronic
968056649 3:195697013-195697035 ACAGGGAGACAATGCAGGAAGGG - Intergenic
969749314 4:9098124-9098146 ACAGTGGGTCAACACCGGGAAGG + Intergenic
969994896 4:11301980-11302002 ACAGTCAGAAAATATTGGGATGG - Intergenic
971551541 4:27964257-27964279 ACAGACAGACAAGACAGGGAAGG - Intergenic
973036670 4:45415756-45415778 ACCCTGAGACAAGACAGTGAAGG - Intergenic
974878017 4:67721245-67721267 GCACTGAGACAGTATAGGGAAGG + Intergenic
977006289 4:91572121-91572143 CCAGTGAGAAAATACGGGAATGG + Intronic
977188910 4:93975848-93975870 ACAGGGAGAAAATACAGGAAAGG - Intergenic
978293531 4:107175503-107175525 AAAGTGAGAAAATAGAGAGAAGG - Intronic
978812841 4:112870667-112870689 ACAGTGTGATACTACAGGCATGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980192369 4:129541430-129541452 ACAGTGAGAGAACACAAAGATGG - Intergenic
981115868 4:140990531-140990553 ACAATGAGAAGACACAGGGAGGG - Intronic
982229446 4:153195150-153195172 ACAGAGACACCATAGAGGGAAGG + Intronic
983097339 4:163579495-163579517 GCAGTGAGAAAGTAAAGGGAAGG + Intronic
985030524 4:185784509-185784531 ACAGAGAGATGATACAGCGATGG + Intronic
985172499 4:187167073-187167095 AAATTGAGACTATACAGGCATGG - Intergenic
985557968 5:567191-567213 CCAGTGGCACAAAACAGGGAGGG + Intergenic
985811155 5:2087517-2087539 AGAGAGAGAGAATTCAGGGAGGG + Intergenic
987135344 5:14894727-14894749 AAAGAGAGACAATAAAAGGATGG + Intergenic
987528287 5:19080954-19080976 ACAGTGAGCCAAAGCAGGGTGGG - Intergenic
988304069 5:29471481-29471503 ACTGTAAGACATTACAGGGAAGG + Intergenic
989434444 5:41394593-41394615 ACAGACTGAAAATACAGGGATGG + Intronic
990493827 5:56326978-56327000 ACTGGGAGACAGGACAGGGAGGG + Intergenic
992424837 5:76646278-76646300 ACAGTGTGACAATTCTGAGATGG - Intronic
992428609 5:76685192-76685214 TCAGGGAGACAATTCAGGGCAGG + Intronic
994538563 5:101063206-101063228 ACTTTAAGACAATACAGAGAAGG - Intergenic
994562333 5:101391402-101391424 ACAGTGATAAAACCCAGGGAGGG + Intergenic
995363456 5:111326748-111326770 GCAGTTGCACAATACAGGGAAGG + Intronic
995423552 5:111993430-111993452 ATAGTGAGAAAAGAAAGGGAGGG - Intronic
996373591 5:122778894-122778916 ACTGTGAAACAAAAAAGGGATGG + Intronic
998552045 5:143087239-143087261 ACAGTGTGAGAAAACAGGGGAGG - Intronic
999858926 5:155624411-155624433 ACAGAGGGACAGTACAGTGAGGG + Intergenic
999933592 5:156460521-156460543 ACAGAGAGACCAGACAGTGATGG + Intronic
1001432721 5:171675686-171675708 ACAGTCAGACCTCACAGGGAAGG - Intergenic
1002969041 6:1995478-1995500 TCTCTGAGACAACACAGGGATGG - Intronic
1003979058 6:11372174-11372196 AAAGACAGACAATAGAGGGATGG - Intronic
1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG + Intergenic
1006119832 6:31797189-31797211 ACAGGGAGAACATACAGGTAGGG + Intergenic
1008707356 6:54179261-54179283 ACAGAGTGAAAATAAAGGGATGG - Intronic
1008983025 6:57507853-57507875 AAAGTTAGAAAATACAGGAAAGG + Intronic
1009171086 6:60400713-60400735 AAAGTTAGAAAATACAGGAAAGG + Intergenic
1009675920 6:66821154-66821176 AAAGTGACACAAGACAAGGATGG - Intergenic
1010620146 6:78063732-78063754 TCATTGAGAAAATACAGGGCTGG + Intergenic
1011391631 6:86859677-86859699 ACAGTTAGACTAAACAGTGAAGG + Intergenic
1013644012 6:112117539-112117561 TCAGGGAGAGTATACAGGGATGG + Intronic
1013770300 6:113620925-113620947 ACAGAGAGACAAGACAGGGTTGG - Intergenic
1016117799 6:140309940-140309962 ACAGGGATACAATACAAGGCTGG - Intergenic
1016646205 6:146411405-146411427 ACAGTGAGACAAGACTGGACAGG + Intronic
1017018836 6:150123785-150123807 AGAGTGAGACAAGAAAGGGAAGG - Intergenic
1017741578 6:157411275-157411297 ACAGTGACATCATACAGAGATGG + Intronic
1018210788 6:161479801-161479823 ACACTGTCACAATACAGGGAGGG - Intronic
1018797172 6:167195424-167195446 ACAGTGAAACATTTCAAGGATGG + Intronic
1019132225 6:169885374-169885396 ACAGTGAGAGAGGGCAGGGAGGG + Intergenic
1020680694 7:11233172-11233194 ACAATGAGATCATACAGGAAAGG - Intergenic
1021314068 7:19124454-19124476 ACAGTGAGACAAGACCAGGCGGG - Intergenic
1022004344 7:26253776-26253798 GCAGTAAGACAAGAAAGGGAGGG + Intergenic
1022337091 7:29432109-29432131 GCAGTGAAAAAAAACAGGGAAGG - Intronic
1024429528 7:49270486-49270508 AACGTGAGACAAAACAGGCATGG - Intergenic
1024701864 7:51912162-51912184 ACAGAGAGACAATACGGTGTAGG - Intergenic
1026153553 7:67808555-67808577 CCAGTCGGAGAATACAGGGAAGG + Intergenic
1027716856 7:81683019-81683041 ACAGTGAGAAAGTCCAGGGGAGG + Intergenic
1028086804 7:86645510-86645532 ACAGTGAGATAACTCAGAGAGGG + Intronic
1028592171 7:92508864-92508886 ACAGTAATACAAGACAGTGAAGG + Intronic
1028801495 7:94970463-94970485 ACAGTGAGACAAAGCAGGGTGGG - Intronic
1031450148 7:121906057-121906079 CCACTGAAACATTACAGGGAAGG - Intronic
1031738545 7:125398345-125398367 ACACTTAGAAAATACTGGGATGG + Intergenic
1032494328 7:132349417-132349439 GCAGGGAGCCAACACAGGGAGGG + Intronic
1033227056 7:139570718-139570740 ACAGTGAGGAAGTAAAGGGAGGG + Exonic
1034238183 7:149589054-149589076 TCAGTGAGTGAAAACAGGGAGGG + Intergenic
1035084280 7:156244393-156244415 ACAGTCTGAAAATAAAGGGATGG - Intergenic
1035692066 8:1566704-1566726 GGATAGAGACAATACAGGGAGGG - Intronic
1037728162 8:21501226-21501248 CCAGTGAGAAAAGACAGTGAGGG - Intergenic
1038081678 8:24144350-24144372 AGACAGAGACAATGCAGGGAAGG + Intergenic
1038400887 8:27283813-27283835 ACTGAGCGACAATAAAGGGAGGG + Intergenic
1038434408 8:27524965-27524987 ACAATGAGTGAATAAAGGGAGGG + Intronic
1038845405 8:31224469-31224491 ACATTGGGAAAATACAGGAACGG + Intergenic
1039383386 8:37107025-37107047 ACAGAGAGACAATAAAAGAAAGG + Intergenic
1039540651 8:38365447-38365469 AGGGTAATACAATACAGGGACGG + Intronic
1041174020 8:55174760-55174782 ACTTAGAGACAATTCAGGGATGG + Intronic
1041938035 8:63356504-63356526 AAAGAGAGATAATACAGGAAGGG - Intergenic
1042723307 8:71846556-71846578 ACAGAGAAAGAAGACAGGGAGGG - Intronic
1042802446 8:72734502-72734524 TCAGTGTGTCAATACAGGTAGGG - Intronic
1044157142 8:88861472-88861494 ACAGAGAGAGGATAAAGGGACGG - Intergenic
1046918816 8:119705772-119705794 AGAGCTAGACAGTACAGGGAAGG + Intergenic
1048294261 8:133202931-133202953 ACCGTGAGAGAATACAGGCCTGG - Intronic
1052103839 9:24486658-24486680 ACAGTTATATAATCCAGGGAAGG - Intergenic
1052412851 9:28145096-28145118 ACACTGTGACAATGCAGTGATGG - Intronic
1054873943 9:70075829-70075851 ACAGTGTGCCACTACATGGATGG - Intronic
1054904573 9:70403367-70403389 ACAGTGATTCATTTCAGGGATGG + Intronic
1055073518 9:72191448-72191470 ACAGGGAGAAAGTAAAGGGAAGG + Intronic
1055406120 9:75975180-75975202 ACAGTGGGAAAACTCAGGGAGGG - Intronic
1055616187 9:78075381-78075403 AAAGTGAGACAGTTAAGGGAAGG + Intergenic
1059837350 9:118170708-118170730 ACAGGGAGAAAATCCTGGGAAGG - Intergenic
1060868806 9:127022572-127022594 ACAGTGAGACAGGACAGGGGTGG - Intronic
1061417584 9:130455512-130455534 ACAGAGAGATAAAAGAGGGAAGG - Intronic
1061701264 9:132417682-132417704 TCAGTGAGACAGTGCAGGCAGGG + Intronic
1062660157 9:137626630-137626652 ACAATGAGACACTAAAGGAAAGG - Intronic
1186654805 X:11601081-11601103 ACAGTCAGACCATACAGGAATGG + Intronic
1186828854 X:13369782-13369804 ACAGTTAGACAATGCACTGAAGG - Intergenic
1187804663 X:23106124-23106146 GCAAAGAGAGAATACAGGGAGGG + Intergenic
1188265982 X:28074988-28075010 ACAGTGACTCAATGCAGGGAAGG + Intergenic
1188318368 X:28704879-28704901 AGAATGAGACAATACTGGGATGG + Intronic
1188909473 X:35828339-35828361 ACAGTCAGTCAATAGATGGATGG - Intergenic
1195808326 X:108800973-108800995 ACAGTGAGCCAAAGCAGGGCGGG + Intergenic
1196481319 X:116153207-116153229 ACAGAGAGAGAATAGAAGGATGG + Intergenic
1197596010 X:128464889-128464911 ACAGGGCGACAATACAGTGGGGG + Intergenic
1197801387 X:130353349-130353371 ACAGTAAGACAAGATAAGGATGG - Intronic
1199938619 X:152602136-152602158 AGAGGTAGACAATTCAGGGATGG + Intergenic