ID: 1079787641

View in Genome Browser
Species Human (GRCh38)
Location 11:24694926-24694948
Sequence CTGTGTAGGGGGCAAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1802
Summary {0: 1, 1: 0, 2: 21, 3: 231, 4: 1549}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079787633_1079787641 -10 Left 1079787633 11:24694913-24694935 CCTATCAGGGGGGCTGTGTAGGG 0: 1
1: 0
2: 1
3: 6
4: 131
Right 1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG 0: 1
1: 0
2: 21
3: 231
4: 1549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079787641 Original CRISPR CTGTGTAGGGGGCAAGGGGA GGG Intronic
900584387 1:3425469-3425491 CTGTGCACGGGGCACGGGGCAGG + Intronic
900680851 1:3915397-3915419 CTGTGGGGGTGGCTAGGGGAGGG - Intergenic
900816014 1:4846546-4846568 AGGTGTGGGGGGCTAGGGGAGGG - Intergenic
900916456 1:5642651-5642673 GAGTGTGGGGGGCTAGGGGAGGG + Intergenic
900940769 1:5797220-5797242 CTGAGTAGGGAGCAAGGGGCTGG - Intergenic
901388926 1:8929951-8929973 CTGGGAAGGGGGCAAGGGAAGGG + Intergenic
901401507 1:9018083-9018105 CAGTGTGGTGGGCAAAGGGATGG - Intronic
901506806 1:9690118-9690140 CCGAATAGGGGGCAGGGGGAGGG - Intronic
901613886 1:10521761-10521783 ATGAGAAGGGGCCAAGGGGATGG - Intronic
901942370 1:12673062-12673084 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
902077753 1:13801170-13801192 CTATGGAGGGGGCAAGGGGAGGG + Intronic
902220829 1:14963771-14963793 GGCAGTAGGGGGCAAGGGGAGGG - Intronic
902570208 1:17342273-17342295 CAGGGGAGGGGGTAAGGGGAAGG - Intronic
903866062 1:26398706-26398728 GGGTGTGGGGGGCAGGGGGAGGG + Intergenic
904003598 1:27351667-27351689 CTGAGCAGGGGTGAAGGGGACGG + Intronic
904986776 1:34557203-34557225 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
905008600 1:34731170-34731192 GAGTGTCGTGGGCAAGGGGAGGG - Intronic
905015223 1:34773499-34773521 CTGGGTCGGGGGCAAGGGGAGGG + Intronic
905194589 1:36265821-36265843 GGGGGTAGGGGGCAAAGGGATGG - Intronic
905302204 1:36993064-36993086 GGGTAAAGGGGGCAAGGGGAGGG + Intronic
906015143 1:42569976-42569998 GTGGGTGGGGGACAAGGGGAGGG + Intronic
906329167 1:44870334-44870356 CTGTGTAGGGCACAAGAGGTAGG - Intronic
906560492 1:46753282-46753304 GTGGGTTGGGGGCAAGGGGAGGG - Intergenic
906724905 1:48037108-48037130 GTGTGTATGTGGAAAGGGGAGGG - Intergenic
907574583 1:55514630-55514652 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
907600661 1:55765896-55765918 GTGGGTAGGAGGCTAGGGGAGGG + Intergenic
907990374 1:59576399-59576421 GGGGGTAGGGGGAAAGGGGAAGG + Intronic
908057588 1:60306365-60306387 CTGGTTAGGGGGAAAGGGAATGG - Intergenic
908250729 1:62263656-62263678 CTGTGTGAGGGGGAAGGAGAGGG - Intronic
908359238 1:63351605-63351627 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908672793 1:66566852-66566874 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
908902188 1:68968451-68968473 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
908917176 1:69142197-69142219 CAGGGTGGGGGGCTAGGGGAGGG + Intergenic
908933553 1:69345494-69345516 GGGTGTTGGGGGCTAGGGGAGGG + Intergenic
909053446 1:70795530-70795552 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
909098796 1:71323748-71323770 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
909343550 1:74558421-74558443 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
909479684 1:76118130-76118152 GGGAGTCGGGGGCAAGGGGAGGG - Intronic
909523750 1:76599439-76599461 GAGGGTGGGGGGCAAGGGGAGGG - Intronic
909708332 1:78613572-78613594 GTGGGTAGGGGGCTGGGGGAGGG + Intergenic
910009180 1:82439396-82439418 GTATGTGGGGGGCTAGGGGAGGG + Intergenic
910153191 1:84179936-84179958 CGGGGTGGGGGGCTAGGGGAGGG - Intronic
910224965 1:84927042-84927064 GGGGGTAGGGGGAAAGGGGAGGG + Intronic
910607662 1:89104767-89104789 TTGTGAACGGGGCAGGGGGAGGG + Intergenic
910632004 1:89364939-89364961 GTGGGTGGAGGGCAAGGGGAGGG - Intronic
910689694 1:89953464-89953486 GTGGGTAGGGAGCAAGGGAAGGG - Intergenic
911064229 1:93773434-93773456 CTGTGCAGGTGGGAAGGGGAGGG + Intronic
911243313 1:95489069-95489091 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
911284081 1:95969117-95969139 GAGGGTTGGGGGCAAGGGGAGGG - Intergenic
911612310 1:99970279-99970301 GTCTGTAGGGGTGAAGGGGACGG + Intronic
911691491 1:100839767-100839789 GGGGGTAGGGAGCAAGGGGAGGG - Intergenic
911746091 1:101443178-101443200 GAGGGTAGGGGGCAGGGGGATGG + Intergenic
911816598 1:102359949-102359971 GGGGGTAAGGGGCAAGGGGAGGG + Intergenic
911875899 1:103162925-103162947 GCGTGTAGGGGGCAAGCAGAGGG - Intergenic
912003587 1:104864827-104864849 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
912235942 1:107850571-107850593 AGGGGTGGGGGGCAAGGGGAGGG + Intronic
912448312 1:109753707-109753729 CTGTGTAATGGGCGAGGGGGAGG - Intronic
912650198 1:111431477-111431499 GCGGGTTGGGGGCAAGGGGAGGG + Intergenic
912676480 1:111686124-111686146 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
912698277 1:111857340-111857362 CTGTGCAGAGGGCACGGGGCTGG + Intronic
913035686 1:114963515-114963537 AGGGGTTGGGGGCAAGGGGAGGG - Intronic
913089746 1:115468476-115468498 CTGTGCAGGGGCAAAGGGAAAGG + Intergenic
913112125 1:115666228-115666250 CTGTGTAGGTGGGAAAGGGCAGG + Intronic
913506374 1:119519854-119519876 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
914247711 1:145898071-145898093 CAGTGTTGGGAGCAAGGGGCAGG + Intronic
914826653 1:151142423-151142445 CTGTGTGGGAGGCAAGGTGCAGG - Intronic
915008883 1:152666172-152666194 GTGGGTAGGGGGCTAGGGGAGGG - Intergenic
915014875 1:152723735-152723757 CTCTGTTGGGGGGAGGGGGAGGG + Intergenic
915338924 1:155165938-155165960 CTCTGCAGGGGGCCAGGGGCAGG - Intergenic
915653461 1:157337308-157337330 GTGGGTTGGGGGCTAGGGGAAGG - Intergenic
915887796 1:159741563-159741585 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
915991666 1:160523800-160523822 CGGGGTGGGGGGCAAGGGGAGGG - Intergenic
915999042 1:160596848-160596870 GTGAGTAGGGGGCTAGGGGAGGG + Intergenic
916013916 1:160731557-160731579 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
916027763 1:160849442-160849464 GTGGGTGAGGGGCAAGGGGAGGG - Intronic
916245702 1:162686358-162686380 CGGGGTGGGGGGCAAGGGGAAGG - Intronic
916251699 1:162744657-162744679 TTGGGTGGGGGGCTAGGGGAGGG - Intronic
916284103 1:163085465-163085487 CTGTGTAGGTCACAAGAGGAGGG - Intergenic
916591395 1:166194395-166194417 GCGGGTGGGGGGCAAGGGGAAGG + Intergenic
916906542 1:169291502-169291524 CGGGGTGGGGGGCTAGGGGAAGG + Intronic
917182373 1:172313937-172313959 GGGGGTAGGGGGCTAGGGGAGGG - Intronic
917263781 1:173197674-173197696 CTGTTGCAGGGGCAAGGGGAGGG + Intronic
917268387 1:173246297-173246319 GGGAGTTGGGGGCAAGGGGATGG - Intergenic
917715193 1:177728195-177728217 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
917913978 1:179682385-179682407 GTGGGTGGGGGGCAAGGGAAGGG - Intronic
918336537 1:183520599-183520621 CTCTGTTGGGGGGAGGGGGAAGG + Intronic
918353216 1:183679378-183679400 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
918410396 1:184252426-184252448 GTGGGTGGGGGACAAGGGGAGGG + Intergenic
918814223 1:189162417-189162439 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
919032053 1:192254426-192254448 GTGTGTGGGAGGCTAGGGGAGGG - Intergenic
919082341 1:192881378-192881400 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
919214943 1:194541199-194541221 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
919412204 1:197259527-197259549 GTGGGGTGGGGGCAAGGGGAGGG + Intergenic
919579671 1:199355856-199355878 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
919806504 1:201383830-201383852 CTGTGGGGGAGGGAAGGGGAGGG - Intronic
919983832 1:202659181-202659203 CTGTGCATTGGGAAAGGGGAGGG - Intronic
920584378 1:207143335-207143357 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
920724371 1:208420015-208420037 CTGTGCAGTGGGCTAGGGGTTGG + Intergenic
920737517 1:208546620-208546642 CTGTGTAGGGTGGGAAGGGAAGG - Intergenic
920818528 1:209358147-209358169 AGGTGTGGGGGGCTAGGGGAGGG + Intergenic
921034083 1:211359720-211359742 CTGAGGAGAGGGCATGGGGAGGG - Intronic
921152353 1:212412582-212412604 CTCTGAAGAAGGCAAGGGGAGGG + Intronic
921319741 1:213927119-213927141 GGGGGTAGGAGGCAAGGGGAGGG + Intergenic
921498890 1:215875987-215876009 CTATGGAGGGGGCGGGGGGAAGG + Intronic
921753063 1:218819912-218819934 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
921955046 1:220973558-220973580 GGGGGTAGGGGGAAAGGGGAGGG + Intergenic
922379466 1:225008065-225008087 CGGGGTTGGGGGTAAGGGGAGGG - Intronic
922412138 1:225387236-225387258 ATGTGTGGGGGGGAGGGGGAGGG + Intronic
922447801 1:225712231-225712253 AAGGGTAGGGGGCAAGGGGAGGG - Intergenic
922586257 1:226736914-226736936 CTGCGGAAGGGGCACGGGGAGGG + Exonic
922692454 1:227705613-227705635 CGGGGTCGGGGGCAAGGGGAGGG + Intergenic
923008510 1:230070446-230070468 CTGTTTAGGGTGGAAAGGGAAGG + Intronic
923069668 1:230550943-230550965 CGGGGTTGGGGGCAAGGGGAAGG - Intergenic
923192846 1:231636945-231636967 GGGGGTAGGGGTCAAGGGGAGGG - Intronic
923265420 1:232309036-232309058 CAGTGTGGTGGGAAAGGGGAGGG - Intergenic
923284047 1:232474073-232474095 CTGTGAATGGGGAAAAGGGATGG + Intronic
923362450 1:233224949-233224971 GGGTTTGGGGGGCAAGGGGAGGG + Intronic
923800699 1:237205736-237205758 CTCTGCAGGGGGCAAGGGCACGG + Intronic
924069772 1:240264522-240264544 GGGGGTAGGGGGCAAAGGGAGGG - Intronic
924220691 1:241872495-241872517 CAGGGTAGGGGGCTAGGGGAGGG - Intronic
924229190 1:241949232-241949254 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
924252831 1:242152496-242152518 GGGGGTAGGGGGCTAGGGGAGGG - Intronic
924299131 1:242619157-242619179 GTGGGTTGGGGGCAAGGGGAGGG + Intergenic
924496644 1:244596608-244596630 TGGGGTGGGGGGCAAGGGGAGGG + Intronic
924509379 1:244716262-244716284 GCCTGTTGGGGGCAAGGGGAGGG + Intergenic
924828473 1:247567318-247567340 GGGTGTGGGGGGCAAGGGGAGGG - Intronic
1063219590 10:3954371-3954393 GTGGGTAGGGGGCAGGGGGAGGG + Intergenic
1063618945 10:7627137-7627159 CGGGGTGGTGGGCAAGGGGAGGG + Intronic
1063628230 10:7711080-7711102 GGCGGTAGGGGGCAAGGGGAGGG - Intronic
1063725200 10:8629630-8629652 AAGGGTAGGGGGCTAGGGGAAGG - Intergenic
1063825001 10:9886522-9886544 CGGGGTTGGGGGCTAGGGGAGGG - Intergenic
1063995226 10:11612000-11612022 CTGAGTAGGGGGCGAGAGGATGG + Intergenic
1064060807 10:12135149-12135171 GGGGGTAGGGGGAAAGGGGAGGG + Intronic
1064652359 10:17522278-17522300 GTGGGTAGGGGTCAAGGGGAGGG - Intergenic
1064729883 10:18319447-18319469 GGGGGTGGGGGGCAAGGGGAAGG + Intronic
1064816616 10:19272674-19272696 GTGGGTGGAGGGCAAGGGGAGGG - Intronic
1064821003 10:19333003-19333025 GAGGGTAGGGGGCTAGGGGAGGG - Intronic
1064876557 10:20001473-20001495 GTGTGGAGGGGGCAAGGGAAGGG + Intronic
1064883115 10:20079783-20079805 GGGGGTAGGGGACAAGGGGAGGG + Intronic
1064891730 10:20182837-20182859 GGGAGTAGGGGACAAGGGGAGGG - Intronic
1065266816 10:23984761-23984783 AGGGGTTGGGGGCAAGGGGAGGG + Intronic
1065399810 10:25286258-25286280 CAGAGTGGGAGGCAAGGGGAAGG - Intronic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1065908175 10:30278122-30278144 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1066066414 10:31764454-31764476 TAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1066187009 10:33019977-33019999 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1066256949 10:33689403-33689425 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1066288187 10:33988963-33988985 GAGGGTGGGGGGCAAGGGGAAGG - Intergenic
1066297062 10:34063536-34063558 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1066588394 10:36963882-36963904 GGGGGTAGGGGACAAGGGGAGGG + Intergenic
1067166045 10:43867379-43867401 CTGGGGCGGGGGCAAGGGCAGGG + Intergenic
1067266905 10:44754342-44754364 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1067357275 10:45541420-45541442 CGGGGTGGGGGGCTAGGGGAGGG + Intronic
1067473825 10:46553705-46553727 TTGTGGAGGGGGAATGGGGAAGG - Intronic
1067911129 10:50348019-50348041 TAGGGTAGGGGGAAAGGGGAGGG - Intronic
1068032733 10:51723472-51723494 GTGGGTAGGAGGCTAGGGGAGGG + Intronic
1068173010 10:53421046-53421068 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
1068404152 10:56568698-56568720 GTGGGTGGGGGACAAGGGGAGGG - Intergenic
1068635867 10:59347668-59347690 CGGGGTGGGGGGCTAGGGGAGGG - Intronic
1068847220 10:61691634-61691656 GGGAGTGGGGGGCAAGGGGAGGG - Intronic
1068922020 10:62494882-62494904 AGGGGTTGGGGGCAAGGGGAGGG - Intronic
1069139381 10:64804473-64804495 CGGGGTGGGGGGCTAGGGGAGGG - Intergenic
1069385871 10:67883244-67883266 TTGCGTGGGGGTCAAGGGGAGGG - Intergenic
1069781248 10:70957107-70957129 CTGAGAAGGGGGCAGGGGGTGGG - Intergenic
1070213732 10:74353407-74353429 GTGGGTAGGGGTCAAGGGGAGGG + Intronic
1070633150 10:78102943-78102965 TTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1070748755 10:78951388-78951410 GTGAGGAGGGGGCAAGGTGATGG - Intergenic
1070752874 10:78974179-78974201 CTGGGGAGGGGGCAGGGGGGAGG - Intergenic
1070878108 10:79834208-79834230 CGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1070908716 10:80098650-80098672 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1070948710 10:80413788-80413810 CTGGGCAGGCGGCAAGGGGAGGG - Intronic
1071005099 10:80875161-80875183 AGGGGTAGGGGGCAAAGGGAGGG - Intergenic
1071143668 10:82542064-82542086 GTGGGTAGAGGGAAAGGGGAGGG - Intronic
1071644657 10:87350541-87350563 CGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1071864168 10:89707642-89707664 GTGTGAAGGGGGAAAGGGGATGG - Intronic
1071963439 10:90829511-90829533 CAGGGTGGGGGGCTAGGGGAGGG - Intronic
1072045445 10:91650136-91650158 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1072886106 10:99275733-99275755 TTTTGTTGGGGGCAAGGGTATGG - Intergenic
1072901133 10:99407952-99407974 GTGGGTGGGAGGCAAGGGGAGGG - Intronic
1073004847 10:100315417-100315439 CGGGGTAGGGGGCAAGGGGAGGG - Intronic
1073037344 10:100573277-100573299 CTGTGTGGCGGGCATGGGGAGGG + Intergenic
1073059543 10:100725074-100725096 GTGTGTATGGGGGAGGGGGAGGG - Intergenic
1073499334 10:103921747-103921769 TTCTGTAGGGGGAAAGTGGAGGG + Intergenic
1073577981 10:104641202-104641224 GTGTGTAGGGGGAGTGGGGAGGG - Exonic
1073626868 10:105107122-105107144 CTGTGTAAGGGTCAAGGTCAAGG - Intronic
1073968951 10:109024730-109024752 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1073983699 10:109183982-109184004 TGGTGTAGGGGGCTAGGGGAGGG - Intergenic
1074015754 10:109532039-109532061 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1074017833 10:109552289-109552311 GGGTGTAGGGGGCTACGGGAGGG + Intergenic
1074048208 10:109858530-109858552 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1074083326 10:110185585-110185607 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1074159085 10:110822312-110822334 CTGTGATGGGGGCAAGAGTAGGG + Intronic
1074633227 10:115282962-115282984 GGGGGTAGGGGGCTAGGGGAGGG - Intronic
1074659717 10:115639962-115639984 GGGTGTAGGGGGCCAGGGGAGGG - Intronic
1074862378 10:117520595-117520617 CTGTGTAGGTGGCAAAGGATTGG + Intergenic
1075122666 10:119675794-119675816 CAGGGAAGGGGGGAAGGGGAAGG - Intronic
1075163789 10:120047770-120047792 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1075355895 10:121775315-121775337 GAGAGTGGGGGGCAAGGGGAGGG + Intronic
1076819216 10:132930474-132930496 CTGTGTGGGGAGTATGGGGAAGG - Intronic
1077032742 11:477015-477037 CTGGGTGGGGGGCAGGGAGAAGG + Intronic
1077154698 11:1086067-1086089 CTGTGGCGGGCCCAAGGGGAGGG + Intergenic
1077714197 11:4565261-4565283 AGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1077787895 11:5404139-5404161 CTGGGTCGGGGGCGGGGGGAGGG + Intronic
1077847614 11:6042662-6042684 CTGTGTCGAGGAGAAGGGGAAGG - Intergenic
1077967471 11:7150492-7150514 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1078114036 11:8426925-8426947 CTGGGAAGGGGGCAAGGGCATGG - Intronic
1078458272 11:11492746-11492768 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1078463049 11:11530083-11530105 CTGTGTTGGGGAGGAGGGGATGG - Intronic
1078493893 11:11796929-11796951 TTGGGTAGGGGGCAGGGGGAGGG - Intergenic
1078621164 11:12909524-12909546 CGGGGTGGGGGGCGAGGGGAGGG + Intronic
1078755880 11:14209402-14209424 GGGTGTGGGGGGCTAGGGGAGGG - Intronic
1078984674 11:16581444-16581466 CTGTGGAGGGTGGAAGGGGAGGG + Intronic
1079082825 11:17425826-17425848 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1079286109 11:19134707-19134729 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1079385037 11:19971381-19971403 CTTTTTAGGGGGCAAGGGGATGG + Intronic
1079489521 11:20972030-20972052 CGGGGTGGGGGGCAAGGGGAGGG + Intronic
1079496800 11:21053261-21053283 CAGGGTGGGGGGCTAGGGGAGGG - Intronic
1079715473 11:23737885-23737907 GGGGTTAGGGGGCAAGGGGAGGG + Intergenic
1079787641 11:24694926-24694948 CTGTGTAGGGGGCAAGGGGAGGG + Intronic
1079905007 11:26233942-26233964 GTAGGTAGGGGGCAAGGGGAGGG + Intergenic
1079943327 11:26710007-26710029 GTGGGTAGGGGGCTAGGGGAGGG - Intronic
1079971761 11:27043584-27043606 CGGGGTAGGGGGCTAGGGGAGGG - Intronic
1079997334 11:27307896-27307918 CAGGGTAGGGGGCAAGGAGGGGG - Intergenic
1080033046 11:27682549-27682571 GGGTGTAGGAGGCTAGGGGAGGG - Intronic
1080037145 11:27721887-27721909 CTGCGTAGTGGGCAAGGGAGCGG - Intronic
1080040686 11:27756604-27756626 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1080069797 11:28068270-28068292 AGGGGTAGGGGGCAAGGGGAGGG + Intronic
1080164354 11:29219139-29219161 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1080396965 11:31899137-31899159 GGGTGTGGGGGGCTAGGGGAGGG - Intronic
1080767036 11:35306677-35306699 GTGAGTGGGGGGAAAGGGGAAGG - Intronic
1080818351 11:35780713-35780735 ATGTGTAGGGGTGATGGGGATGG - Intronic
1080844278 11:36013448-36013470 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1080919875 11:36698390-36698412 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1080996262 11:37606084-37606106 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1081251789 11:40845296-40845318 ACATGTAGGTGGCAAGGGGAGGG - Intronic
1081255168 11:40884055-40884077 CGGGGTAGGGGGAAAGGAGAGGG - Intronic
1081267982 11:41050435-41050457 TGGGGTAGGGGGCAAGGGGAGGG - Intronic
1081484185 11:43515367-43515389 CTGTGGAGGGGGCAAGGCGTGGG + Intergenic
1081594933 11:44452599-44452621 CTGAGTGGGGGTCAAGGGGTAGG + Intergenic
1081621266 11:44620269-44620291 CCTTGTAGGGGGAGAGGGGAGGG + Exonic
1081651948 11:44830068-44830090 GTGTGGAGTGGGCTAGGGGAAGG - Intronic
1081682520 11:45018125-45018147 GGAGGTAGGGGGCAAGGGGAGGG + Intergenic
1081717226 11:45259071-45259093 TTTTGCAGGGGGCAAGGGGGTGG - Intronic
1081790974 11:45784441-45784463 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
1081865481 11:46357446-46357468 CTTTGTTGGGTACAAGGGGATGG - Intronic
1082256421 11:50038180-50038202 GGGGGTAGGGGGAAAGGGGAGGG - Intergenic
1082637795 11:55617679-55617701 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1082673180 11:56059724-56059746 GGGTGTAGGGGGCTAGGGGACGG + Intergenic
1082763475 11:57148426-57148448 CTGTGCTGGGGGTATGGGGAAGG - Intergenic
1082886341 11:58087706-58087728 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1083102940 11:60329134-60329156 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG + Intergenic
1083889427 11:65588609-65588631 CTGTGTCGGGGTCATGGGGCAGG - Intronic
1084944292 11:72630566-72630588 TTGTGGAGGGGGCATGGGGGTGG + Intronic
1085434391 11:76486251-76486273 GCGGGTGGGGGGCAAGGGGAGGG + Intronic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1085490332 11:76910123-76910145 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1085899681 11:80684050-80684072 GTGGGTAGGGGACAAGGGGAGGG - Intergenic
1086028098 11:82319208-82319230 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1086037570 11:82435337-82435359 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1086047324 11:82548329-82548351 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1086253097 11:84840840-84840862 TGGGGTAGGGGGCAGGGGGAGGG + Intronic
1086277444 11:85147894-85147916 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1086307986 11:85502650-85502672 GCGGGTTGGGGGCAAGGGGAGGG + Intronic
1086552365 11:88067748-88067770 GGGTGTGGGTGGCAAGGGGAGGG + Intergenic
1086972852 11:93102301-93102323 AGGGGTGGGGGGCAAGGGGAAGG - Intergenic
1087206352 11:95400112-95400134 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1087399077 11:97641175-97641197 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1087423508 11:97963285-97963307 AGGGGTGGGGGGCAAGGGGAAGG - Intergenic
1087435874 11:98116963-98116985 GGGAGTTGGGGGCAAGGGGAGGG - Intergenic
1087980381 11:104605761-104605783 GTGGGTAGGGGGCTAGGGGAGGG + Intergenic
1088514014 11:110609138-110609160 CTGGGTAGGGGGCAGGAGGGAGG - Intronic
1088624274 11:111717912-111717934 CTGTTAGGGGGGCAATGGGAGGG + Intronic
1088638655 11:111849625-111849647 CTGTGGAGGGGGCGGAGGGAGGG - Intronic
1089284878 11:117399126-117399148 CAGGGTTGGGGGCTAGGGGAGGG - Intronic
1089503738 11:118949240-118949262 TGGGGTAGGGGGCAGGGGGAGGG - Intronic
1090039907 11:123281617-123281639 GGGGGTAGGGGACAAGGGGAGGG + Intergenic
1090324891 11:125876763-125876785 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1090627863 11:128621680-128621702 ATGTGTGTGGGGCCAGGGGAGGG - Intergenic
1090910756 11:131117266-131117288 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1090927912 11:131267914-131267936 TGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1091365007 11:135011320-135011342 GTGGGTAGGGGGCTAGTGGAGGG - Intergenic
1091422156 12:351200-351222 GGGAGTAGGGGGCTAGGGGAGGG - Intronic
1091820222 12:3470577-3470599 CTGGGTGGGGGGCATGGGGCAGG + Intronic
1092217578 12:6693961-6693983 CTGAGGAGGGGGAAAGGGCAGGG + Exonic
1092322808 12:7496327-7496349 ATGGGTGGGGGGAAAGGGGAGGG + Intronic
1092438540 12:8475024-8475046 TAGGGTAGGGGGCTAGGGGAGGG - Intronic
1092496888 12:9005203-9005225 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1092550798 12:9496993-9497015 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1092646736 12:10582514-10582536 CGGGGTAGAGGGCAAGGGGAGGG + Intergenic
1092943561 12:13432954-13432976 GCGGGTGGGGGGCAAGGGGAGGG - Intergenic
1093504162 12:19845458-19845480 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1093734644 12:22606546-22606568 CGGGGTGGGGGGCTAGGGGAGGG + Intergenic
1093740134 12:22676150-22676172 GTGGGTAGGGGGCTAGGGAAGGG - Intronic
1093977276 12:25437222-25437244 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1094111578 12:26868328-26868350 GGGTGTAGGGGACTAGGGGAGGG + Intergenic
1094353720 12:29555465-29555487 GGGGGTAGGGGGCAAGAGGAGGG - Intronic
1094379532 12:29828331-29828353 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1094391037 12:29950546-29950568 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
1094521020 12:31189376-31189398 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1094598310 12:31885293-31885315 GGGGGTGGGGGGCAAGGGGAAGG + Intergenic
1094782625 12:33810035-33810057 CAGGGTAGGGGGCTAGGGGAGGG - Intergenic
1095229806 12:39726303-39726325 GGGTGTGGGGGGCTAGGGGAGGG - Intronic
1095400531 12:41809577-41809599 GGGTGTAGGGGGCAAGGAGAGGG + Intergenic
1095438982 12:42223875-42223897 GGGGGTGGGGGGCAAGGGGAAGG + Intronic
1095445597 12:42279033-42279055 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1095779351 12:46041922-46041944 GGGTGTCGGGGGCTAGGGGAGGG + Intergenic
1095851335 12:46810388-46810410 GTGGGTAGGGGGCTAGGGGAGGG + Intronic
1096205055 12:49714366-49714388 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
1096345702 12:50844339-50844361 CTGGGTAGGGGGCTAGGGGAGGG - Intronic
1096424907 12:51492831-51492853 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1096675470 12:53223454-53223476 CCGGGTAGGGGGCCAGGAGAGGG + Intronic
1096850256 12:54430911-54430933 CTCTGTAGGGGGTGATGGGAAGG + Intergenic
1096883658 12:54694900-54694922 GGGGGTAGGGGACAAGGGGAGGG + Intergenic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097064791 12:56313122-56313144 GGGTGTTGGGGGCTAGGGGAGGG - Intronic
1097114563 12:56687999-56688021 TTGTGAACGGGGCAGGGGGACGG + Exonic
1097129408 12:56799702-56799724 GGGTGTGGGGGGCAAGGGAAGGG + Intergenic
1097297310 12:57980568-57980590 GGGAGTAGGGGGCTAGGGGAGGG + Intergenic
1097768984 12:63558430-63558452 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1098147773 12:67515470-67515492 CTGTGTGATGGGCAAGGGGGTGG + Intergenic
1098284369 12:68892966-68892988 GAGGGTTGGGGGCAAGGGGAGGG + Intronic
1098337125 12:69415705-69415727 CTGTGTATGGGGACAGGTGAGGG + Intergenic
1098458010 12:70698215-70698237 TTGTATGGGGGGCAAGGGGAGGG - Intronic
1098465701 12:70783849-70783871 CTGTGTGGGGGGGACGGGGGGGG + Intronic
1098660302 12:73085056-73085078 GGGTATAGGGGGCGAGGGGAGGG + Intergenic
1098761217 12:74427677-74427699 AGGGGTAGGGGGAAAGGGGAGGG - Intergenic
1098776656 12:74629198-74629220 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1098796428 12:74893929-74893951 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1098991509 12:77068966-77068988 TGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1099042721 12:77676237-77676259 GTGGGTGGGGGGCAAGGGAAGGG - Intergenic
1099052176 12:77793463-77793485 GGGTGTGGGGGGCAAGTGGAGGG - Intergenic
1099125800 12:78755938-78755960 CGGGGTCGGGGGCTAGGGGAGGG + Intergenic
1099268969 12:80483725-80483747 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
1099316995 12:81096612-81096634 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1099338371 12:81394654-81394676 GGGTGTTGGGGGCAAGGGGAGGG + Intronic
1099528361 12:83743170-83743192 GGGTGTGGGGGACAAGGGGAGGG + Intergenic
1099583008 12:84477179-84477201 GTGGGGAGGGGGCCAGGGGAAGG + Intergenic
1099687649 12:85909835-85909857 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1099688580 12:85921840-85921862 CTGTTTGGGGGGCATGGGGGAGG - Intergenic
1099806553 12:87527512-87527534 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1099809472 12:87562206-87562228 GGGAGTGGGGGGCAAGGGGAGGG + Intergenic
1099937909 12:89149883-89149905 TTGGGTAGGGGGCAGGGGTAGGG + Intergenic
1100065133 12:90634549-90634571 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1100128723 12:91462944-91462966 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
1100317195 12:93455258-93455280 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1100354762 12:93818630-93818652 CTGCAGAGGGGGCAAGGGGTGGG + Intronic
1100550561 12:95643168-95643190 ATGTGTAGGGGGCAATGGGTTGG - Intergenic
1100554397 12:95678187-95678209 GGGTGTGGGGGGCGAGGGGAGGG + Intronic
1100670147 12:96802819-96802841 GTGGGTAGGGAGCAGGGGGAGGG - Intronic
1100671194 12:96814696-96814718 GTGGGTTGGGGACAAGGGGAAGG - Intronic
1100761268 12:97810210-97810232 GGGGGTAGGGGGCTAGGGGAAGG + Intergenic
1100942762 12:99741743-99741765 CGAGGTGGGGGGCAAGGGGAGGG + Intronic
1101007191 12:100412410-100412432 CCTGCTAGGGGGCAAGGGGAGGG + Intronic
1101245214 12:102878379-102878401 CAGTGTAGTGGGGAAGGGGTTGG + Intronic
1101246522 12:102888956-102888978 CTGAGAAGAGGGCAATGGGAAGG + Intronic
1101568604 12:105932979-105933001 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1101601896 12:106216900-106216922 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1101727442 12:107399828-107399850 GGCTGTCGGGGGCAAGGGGAGGG - Intronic
1101742124 12:107508851-107508873 CTGTTTAGGGGACAAGGGAAAGG + Intronic
1101993718 12:109509413-109509435 AGGGGTAGGGGGAAAGGGGAGGG - Intronic
1102405344 12:112668657-112668679 GGGTGGTGGGGGCAAGGGGAGGG + Intronic
1102601824 12:114037233-114037255 CTGGGAAGGGAGCGAGGGGAGGG - Intergenic
1102819358 12:115894788-115894810 GTGAGAAGGGAGCAAGGGGAGGG + Intergenic
1102976251 12:117209049-117209071 CGGGGGAGGGGGCATGGGGAGGG - Exonic
1103186901 12:118966173-118966195 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1103361352 12:120356267-120356289 CTTTGGAGGGGGCAAAAGGAAGG - Intronic
1103524350 12:121557912-121557934 CTGGGAGGGAGGCAAGGGGAGGG - Intronic
1103867497 12:124064492-124064514 CTGTGTTTTGGGAAAGGGGAGGG + Intronic
1103978626 12:124720987-124721009 CTGTGGAAGGAACAAGGGGAGGG + Intergenic
1104096358 12:125561371-125561393 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
1104485637 12:129149227-129149249 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1104499514 12:129271551-129271573 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1104515159 12:129418560-129418582 GTGGGTGGGGGACAAGGGGAGGG + Intronic
1104542099 12:129675373-129675395 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1104608830 12:130211258-130211280 GCGGGTGGGGGGCAAGGGGAGGG - Intergenic
1104963308 12:132498240-132498262 CTGTGTCGGGGGCATGGGGCCGG + Intronic
1105317753 13:19282722-19282744 CGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1105957109 13:25294001-25294023 GGGGTTAGGGGGCAAGGGGAGGG - Intergenic
1106130882 13:26938571-26938593 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1106430154 13:29673258-29673280 CAGGGTCGGGGGCAAGGGGAGGG + Intergenic
1106443226 13:29799208-29799230 CTTTGCCGGGGGCAGGGGGAAGG - Intronic
1106481365 13:30139558-30139580 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1106534593 13:30628529-30628551 GCGGGTAGGGGGCTAGGGGAGGG - Intronic
1106649833 13:31678274-31678296 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1106748341 13:32729087-32729109 TGGGGTGGGGGGCAAGGGGAGGG - Intronic
1106918299 13:34538597-34538619 CTGGGTAGGAGGGAAGGGGGTGG + Intergenic
1107004698 13:35595785-35595807 GGGTGTAGGGGGCACGGGGAAGG - Intronic
1107059305 13:36139461-36139483 CTGGGTGGGGGGCAGTGGGAGGG - Intergenic
1107324527 13:39226770-39226792 GGGAGTAGGGGGCAAGGGGAGGG + Intergenic
1107713534 13:43174606-43174628 CAGGGTGGGGGGCAAGGAGAGGG - Intergenic
1107820893 13:44284823-44284845 GGGAGTTGGGGGCAAGGGGAGGG - Intergenic
1107886961 13:44881570-44881592 CAGTGTGGGGGGCGAGGGAATGG + Intergenic
1108047271 13:46395128-46395150 AGGGGTGGGGGGCAAGGGGAGGG + Intronic
1108130769 13:47297651-47297673 TGGGGTAGGGGGCGAGGGGAGGG + Intergenic
1108165863 13:47692435-47692457 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1108320971 13:49290163-49290185 CTGAGTGGGGTGAAAGGGGATGG + Intronic
1108351941 13:49595862-49595884 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1108459067 13:50647148-50647170 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1109329242 13:60906890-60906912 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
1109568450 13:64152375-64152397 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1109584625 13:64383031-64383053 TGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1109611517 13:64771467-64771489 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
1109679698 13:65733975-65733997 TGGGGTAGGGGACAAGGGGAGGG + Intergenic
1109838668 13:67893108-67893130 GGGTGTGGGGTGCAAGGGGAGGG + Intergenic
1109878150 13:68432126-68432148 GTGTGTGGGGGACAAGGAGAGGG + Intergenic
1109904871 13:68827581-68827603 AGGGGTAGGGGACAAGGGGAGGG - Intergenic
1109930244 13:69206588-69206610 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1110200553 13:72845130-72845152 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1110331260 13:74276119-74276141 GGGAGTAGGGAGCAAGGGGAGGG - Intergenic
1110394972 13:75019179-75019201 CGGGGTAGGGGACAAGGGGAGGG + Intergenic
1110715968 13:78704462-78704484 AAGGGTTGGGGGCAAGGGGAAGG + Intergenic
1110736909 13:78947955-78947977 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1110752886 13:79136368-79136390 AGGGGTAGGGAGCAAGGGGAGGG + Intergenic
1110780737 13:79461730-79461752 TGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1110822690 13:79934771-79934793 GTGGGTGGAGGGCAAGGGGAGGG + Intergenic
1110868470 13:80423402-80423424 GAGGGTGGGGGGCAAGGGGAGGG - Intergenic
1110869567 13:80434757-80434779 GGGGGTAGGGGGTAAGGGGAGGG - Intergenic
1111199080 13:84910101-84910123 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1111468558 13:88647407-88647429 CTGTGGAGGGGACAACCGGAGGG + Intergenic
1111782132 13:92741727-92741749 TGGTGTAGGGGGAGAGGGGAGGG - Intronic
1111814840 13:93139490-93139512 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1111830468 13:93322930-93322952 GGGTGTGGGGGGCTAGGGGAGGG - Intronic
1111850439 13:93566706-93566728 AAGGGGAGGGGGCAAGGGGAGGG - Intronic
1111861852 13:93717752-93717774 AGGGGTGGGGGGCAAGGGGAAGG - Intronic
1111915463 13:94355928-94355950 CTGTTGTGGGGGCAGGGGGAGGG - Intronic
1111998520 13:95189036-95189058 GTGGGTGGGGGGCAAGGGGAGGG - Intronic
1112152486 13:96779169-96779191 ATGAGTGGGGGGCTAGGGGAGGG + Intronic
1112420888 13:99247585-99247607 ATGGGTAAGGGGCAAGGGGAGGG + Intronic
1112628176 13:101129862-101129884 CGGGGTGGGGGGCAAGGGGAGGG - Intronic
1112630810 13:101159460-101159482 TTGTGTAGGTGGCCAGGGGTCGG + Intronic
1112705040 13:102059187-102059209 ATGTCTAGGAGGCAAGTGGAAGG + Intronic
1112836639 13:103522795-103522817 CAGGGTAGGGGGAAAGGTGAGGG + Intergenic
1112907805 13:104445896-104445918 CGGGGTGGGGGTCAAGGGGAGGG + Intergenic
1112911698 13:104493473-104493495 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1113062062 13:106332642-106332664 GTGTGTTGGGGGCAGGGGGGCGG - Intergenic
1113209640 13:107960539-107960561 CTTTGCAGGGGGCTGGGGGATGG + Intergenic
1113359407 13:109615732-109615754 GGGTGTGGGAGGCAAGGGGAGGG - Intergenic
1113541992 13:111115865-111115887 TTGTGTGCGGGGCAGGGGGAGGG + Intronic
1113694764 13:112336684-112336706 CTGTGGTGGGGGCAGAGGGAGGG + Intergenic
1114132973 14:19814812-19814834 CAGGGTGGGGGGCTAGGGGAAGG - Intronic
1114529792 14:23388552-23388574 CTGTGTGGGGGGTGAGGGCAGGG - Intronic
1114591704 14:23871068-23871090 AGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1114742858 14:25115953-25115975 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1114762934 14:25337485-25337507 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1114966359 14:27966164-27966186 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1115016075 14:28615955-28615977 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1115161783 14:30404638-30404660 GGGTGTAGGGGGATAGGGGAGGG - Intergenic
1115760803 14:36578551-36578573 TTGTGTACTGGGCAAGAGGAGGG - Intergenic
1116027151 14:39528354-39528376 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1116177955 14:41497098-41497120 GTGGGTAGGGGGCAAGGAGAGGG + Intergenic
1116227076 14:42166167-42166189 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1116271531 14:42775064-42775086 CTGTTGCGGGAGCAAGGGGAGGG + Intergenic
1116362571 14:44020681-44020703 GGGGGTAGGGGGTAAGGGGAAGG - Intergenic
1116551411 14:46244225-46244247 GTGTGTTGGAGACAAGGGGAAGG - Intergenic
1116767052 14:49085714-49085736 CGGGGTTGGGGGCTAGGGGAGGG - Intergenic
1117015645 14:51514346-51514368 GGGGTTAGGGGGCAAGGGGAGGG + Intronic
1117444984 14:55795484-55795506 GTGTGTAGGGGGCGAGTGGCAGG + Intergenic
1117630131 14:57682488-57682510 TGGGGTAGGGGGCTAGGGGAGGG + Intronic
1117640365 14:57791964-57791986 GAGGGTGGGGGGCAAGGGGAGGG + Intronic
1117642159 14:57811460-57811482 CTTTGAAGGTGGAAAGGGGAAGG - Intronic
1117849524 14:59952799-59952821 CGAGGTGGGGGGCAAGGGGAGGG - Intronic
1118048002 14:61993263-61993285 GGGTGTGGGGGGCAAGGGGAGGG + Intergenic
1118694771 14:68373618-68373640 GTGGGTGGGGGGCAAGGGCAAGG + Intronic
1119586439 14:75840386-75840408 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1120122189 14:80694749-80694771 GGGGGTAGGGGGCAAGGGGAAGG + Intronic
1120207516 14:81602403-81602425 CGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1120311073 14:82829166-82829188 GTGTTTGGGGGGTAAGGGGAAGG + Intergenic
1120449533 14:84649770-84649792 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1121272164 14:92645077-92645099 ATGTGCAGGGAGCAAGGGGCTGG - Intronic
1121522271 14:94594218-94594240 CTGTGTGGGGGGTCAGGGGTGGG + Intronic
1121642805 14:95497141-95497163 CTGTGTGGGGGGACAGGGGCTGG - Intergenic
1121906565 14:97751619-97751641 GTGTTTAGGAGGAAAGGGGAGGG - Exonic
1122075303 14:99231602-99231624 CTGTGTGAGGGGCACGGGGTGGG + Intronic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122366805 14:101199221-101199243 CTGGGCAGGGGGCAGGGGGCAGG + Intergenic
1122537333 14:102474840-102474862 CTTTGTGTGGGGCAGGGGGAAGG - Intronic
1122675491 14:103409295-103409317 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1122795744 14:104205315-104205337 CAGTGTAGGGGGCAAGGGACAGG + Intergenic
1122825196 14:104367370-104367392 CAGTGGAGGTGGCAAGGGCAGGG - Intergenic
1122871360 14:104640520-104640542 GTGTGTAGGAGCCAAGGGGGAGG - Intergenic
1123048001 14:105527748-105527770 CTGTGGAGGGGGTGAGGGGCTGG + Intronic
1123178533 14:106445012-106445034 CGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1123576063 15:21670624-21670646 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1123612684 15:22113098-22113120 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1123986280 15:25649160-25649182 CTGTGTAGGGGAGAAGAGGAGGG + Intergenic
1124385203 15:29202627-29202649 AGGGGTTGGGGGCAAGGGGAGGG - Intronic
1124699412 15:31899396-31899418 ATGGGTGGGGAGCAAGGGGAGGG + Intergenic
1125006947 15:34827347-34827369 GGGGGTAGGGGGAAAGGGGAGGG + Intergenic
1125142282 15:36422436-36422458 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1125635885 15:41188336-41188358 GAGTGGAGGGGACAAGGGGAGGG - Intronic
1125977491 15:43967908-43967930 AGGGGTTGGGGGCAAGGGGAGGG - Intronic
1126419493 15:48456409-48456431 GTGTGTTGGGGGAAAGGGGCTGG + Intronic
1126559915 15:50032175-50032197 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1126569893 15:50139436-50139458 GGGGGTTGGGGGCAAGGGGAGGG + Intronic
1126617699 15:50602383-50602405 TGGGGTAGGGGGCAGGGGGAGGG + Intronic
1126808961 15:52381419-52381441 CTGTGGAGGGGGTGAGGGGTGGG + Intronic
1126928740 15:53622622-53622644 CTGAGGAGGGAGCAGGGGGAGGG + Intronic
1127074953 15:55316429-55316451 GCGGGTGGGGGGCAAGGGGAGGG + Intronic
1127168742 15:56276320-56276342 AGGTGTGGGGGGCAAGAGGAGGG - Intronic
1127725505 15:61745388-61745410 CTGTGGACGGGGCAAGGGGATGG - Intergenic
1128037933 15:64542992-64543014 GCGGGTGGGGGGCAAGGGGAGGG + Intronic
1128050022 15:64655888-64655910 GTCTGTAGGGGGCAGGGGCATGG + Intronic
1128211470 15:65906228-65906250 CTGGGTAGGGGAGAAGGGGGGGG - Intronic
1128332454 15:66764665-66764687 CTGTGTATGGGCCCAGAGGAGGG + Intronic
1128685820 15:69684859-69684881 GGGGGTCGGGGGCAAGGGGAGGG - Intergenic
1128780787 15:70357421-70357443 CTGTGTTGTGGGGGAGGGGATGG + Intergenic
1128892731 15:71345210-71345232 GTGGGTAGGGGGCAAAGGGAAGG + Intronic
1129265047 15:74388885-74388907 CTGGGTAGGGAACAAGGGGCAGG - Intergenic
1129386819 15:75201036-75201058 GTGTGCAGTGGGGAAGGGGAGGG - Intronic
1129417971 15:75398869-75398891 GGGGGTAGGAGGCAAGGGGAGGG + Intronic
1130118320 15:81024735-81024757 CTGTGGTGGAGGCAGGGGGAAGG + Intronic
1130233865 15:82116654-82116676 ATGGGTAGGAGGCAAAGGGATGG - Intergenic
1130546865 15:84863164-84863186 TTATGTATGGGGCAGGGGGAAGG - Intronic
1130556526 15:84926783-84926805 CTGTGTGGGGGGTGGGGGGAGGG + Intronic
1130603730 15:85296350-85296372 GGGGGTAGGGGGCAAGAGGAGGG - Intergenic
1130677888 15:85969955-85969977 GGATGTAGGGGGCTAGGGGAGGG - Intergenic
1130740613 15:86595816-86595838 ATGGGCAGGGGGCAAGGGAATGG + Intronic
1130848856 15:87773877-87773899 AGGGCTAGGGGGCAAGGGGAGGG + Intergenic
1131004221 15:88963305-88963327 TTGTGTACGGGGCAAGAGAAGGG + Intergenic
1131064450 15:89424862-89424884 CTGGGTTTGGGGCAGGGGGAAGG + Intergenic
1131361886 15:91800225-91800247 GTGGGTTGGGGGCTAGGGGAGGG - Intergenic
1131461336 15:92619667-92619689 CTGTGTGGGGAGCTGGGGGAGGG - Intronic
1131708197 15:95021443-95021465 GTGTGTAGGAGGGAGGGGGAAGG - Intergenic
1131772757 15:95758047-95758069 GTGGGTAGGGAGAAAGGGGAGGG + Intergenic
1131829342 15:96344253-96344275 GTGGGTGGGGGGCAAGGGAAGGG + Intergenic
1131915293 15:97258315-97258337 TTTTGTAGGGAGCAAGGGAAAGG + Intergenic
1202984931 15_KI270727v1_random:404869-404891 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1132720588 16:1313776-1313798 CTGGGTTGGGGCCATGGGGAGGG + Intronic
1133431146 16:5737997-5738019 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1133902655 16:9991900-9991922 GGGGGTAGTGGGCAAGGGGAGGG + Intronic
1134114205 16:11535958-11535980 CTGGGTAGGGGGCAAGAGAGGGG + Intergenic
1134188405 16:12101907-12101929 GAGGGTAGGGGGCTAGGGGAGGG - Intronic
1134368168 16:13598537-13598559 CTCTGAAGGGGGCAAGGACATGG - Intergenic
1134424062 16:14122425-14122447 CAGGGTAGGGGGCTAGGGGAGGG - Intronic
1135012626 16:18895526-18895548 CACTCTAGGGGGCAGGGGGAAGG + Intronic
1135113359 16:19707663-19707685 CTGTGTAGGGAGGTGGGGGAGGG - Intronic
1135472187 16:22741201-22741223 AGGGGTCGGGGGCAAGGGGAGGG - Intergenic
1135662078 16:24305645-24305667 CTGGGTGGGGAGCAAGAGGAGGG + Intronic
1135759891 16:25128906-25128928 AGGGGTGGGGGGCAAGGGGAGGG + Intronic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1135830782 16:25771130-25771152 GGGTGTGGGGGGCAAGGGAAGGG - Intronic
1135974800 16:27101204-27101226 GCGGGTGGGGGGCAAGGGGAGGG + Intergenic
1136479078 16:30530471-30530493 CTGTGTTGAGGGTTAGGGGAGGG + Intronic
1137305431 16:47194868-47194890 GGGAGTCGGGGGCAAGGGGAGGG - Intronic
1137456677 16:48623114-48623136 GTGGGTGGGGGGCAAGCGGAGGG - Intergenic
1137882030 16:52059203-52059225 CATTATAGGGGGGAAGGGGATGG + Intronic
1138084259 16:54119431-54119453 CAGAGTTGGGGGCAGGGGGAAGG - Exonic
1138736068 16:59251633-59251655 GTGGGTAGGGGGCTAGGGGAGGG - Intergenic
1138927018 16:61604583-61604605 CAGGGTTGGGGGCAAAGGGAGGG + Intergenic
1138994228 16:62428704-62428726 GAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1139083301 16:63552446-63552468 TCGTGTGGGGGGCAAGGGGAGGG + Intergenic
1139367610 16:66443168-66443190 CTTTGGAGTGAGCAAGGGGATGG + Intronic
1139457330 16:67092051-67092073 AGGGGTAGGGGGGAAGGGGAGGG - Intronic
1139842420 16:69892332-69892354 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140559078 16:75956106-75956128 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1140592335 16:76368672-76368694 TGGGGTAAGGGGCAAGGGGAGGG + Intronic
1140604268 16:76516083-76516105 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1140831422 16:78755048-78755070 GGGGGTAGGGGGAAAGGGGAGGG + Intronic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141316791 16:82970078-82970100 ATGGGTAGGGGTCTAGGGGAGGG - Intronic
1141722927 16:85766780-85766802 CTGGGAAGGGGGCACAGGGAAGG - Intergenic
1141896541 16:86962227-86962249 CTGGGCAGGGGGCAAGGAGGTGG + Intergenic
1142126321 16:88412296-88412318 CTGTGGAGAGGGCACTGGGAAGG - Intergenic
1142719155 17:1764787-1764809 ATGTGTTGGGGGCCAGGGCAGGG + Intronic
1142755623 17:2014932-2014954 CTGTGGTGGGGCCAGGGGGAAGG + Intronic
1142914446 17:3124465-3124487 GGGGATAGGGGGCAAGGGGAGGG + Intergenic
1142929129 17:3267390-3267412 CTCTGTAGCTAGCAAGGGGATGG + Intergenic
1142931288 17:3286056-3286078 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1143005160 17:3827070-3827092 AAGGGTAGGGGGAAAGGGGAAGG + Intronic
1143134547 17:4704174-4704196 CTGGGGAGGGGGCGTGGGGAGGG + Exonic
1143182811 17:4994358-4994380 CTGGGTGGGGAGCATGGGGATGG - Intronic
1143248196 17:5503077-5503099 GTGTGTAGGGTGCAATGGGAGGG + Intronic
1143248214 17:5503185-5503207 GTGTGTAGGGTGCAATGAGAGGG + Intronic
1143278853 17:5735021-5735043 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1143304387 17:5934288-5934310 GTGGGTGGGGGGCAAGGGGAGGG - Intronic
1143332539 17:6148332-6148354 ACGTGTAGGGGGCCAGTGGAGGG - Intergenic
1143415067 17:6741152-6741174 GAGGGTGGGGGGCAAGGGGAAGG + Intergenic
1143565481 17:7717834-7717856 GTGTGTCGGGGGCAGAGGGAAGG + Exonic
1143660523 17:8321946-8321968 CAGTGTTTGGGGCAAGGAGAAGG - Exonic
1143934057 17:10463712-10463734 CTGTGCAGGGGCAATGGGGAAGG - Intronic
1144027591 17:11292277-11292299 CAGAGTAGGGGGAAAGGGGAGGG - Intronic
1144035409 17:11360630-11360652 GGGGGTAGGGGGCAAGGGAAGGG + Intronic
1144046545 17:11459286-11459308 CAGTGTAGGAGGGTAGGGGAGGG - Intronic
1144122751 17:12172307-12172329 CTGGGTCGGGGGCAGGGGGATGG - Intergenic
1144130447 17:12241847-12241869 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1144150912 17:12444679-12444701 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
1144328550 17:14204684-14204706 GTGTGTAGGGGGTGAGGGGAGGG - Intronic
1144433871 17:15221869-15221891 CGGGGTAGGAGGCTAGGGGAGGG - Intergenic
1144626937 17:16848794-16848816 CTGGGTGGGGGGGCAGGGGAAGG - Intergenic
1144879502 17:18423918-18423940 CTGGGTGGGGGGGCAGGGGAAGG + Intergenic
1145104116 17:20100806-20100828 GTGGGTAGGGGGCAAGGGGAGGG - Intronic
1145152738 17:20520469-20520491 CTGGGTGGGGGGGCAGGGGAAGG - Intergenic
1145199026 17:20923336-20923358 GTGGCTGGGGGGCAAGGGGAGGG - Intergenic
1145908658 17:28530034-28530056 AGGGGTTGGGGGCAAGGGGAGGG + Intronic
1146012779 17:29208871-29208893 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1146110804 17:30087443-30087465 CTGTCAAGGGGGCGAGGGTAGGG - Intronic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146490211 17:33275732-33275754 CTGTGGAGTGGGTAAGGGTAAGG - Intronic
1146533589 17:33631056-33631078 CTGGGTAAGGAGCAAGTGGAAGG + Intronic
1146556636 17:33830705-33830727 GAGGGTAGGGGGCAAGGGGAGGG - Intronic
1146671017 17:34737853-34737875 CTGCCTGGGGGGCAAGGGGAGGG - Intergenic
1146783863 17:35701508-35701530 CTGTGAAGGAGGCATGGGGCTGG - Intronic
1147047402 17:37763713-37763735 GTGGGTAGGGGGCAAGGGGAGGG - Intergenic
1147219306 17:38919245-38919267 CTGTGTAGGGACCAGTGGGATGG + Exonic
1147325085 17:39666213-39666235 CAGAGTTGGGGGCTAGGGGAGGG + Exonic
1147517500 17:41135027-41135049 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1147529517 17:41262170-41262192 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
1147613289 17:41813592-41813614 CAGTGTTGGGGGGAAGGGGGTGG + Intronic
1147665007 17:42141259-42141281 TAGTGTAGGTGGCAAGGGGCTGG + Intronic
1147986280 17:44309217-44309239 CTGTGTGAGGGGGAAGGGGGTGG + Intronic
1148011105 17:44482219-44482241 GTGGGTGGGGGGCAAGGGGAGGG + Intronic
1148871718 17:50662317-50662339 CTGGGTGGGGGGCAAGGTGGTGG + Intronic
1149020324 17:51955827-51955849 GGGGGTAGGGGGAAAGGGGAGGG + Intronic
1149049779 17:52290776-52290798 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1149131800 17:53311111-53311133 GAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1149168790 17:53784770-53784792 GTGGGTAGGGGGCAGGGGAAGGG + Intergenic
1149250764 17:54766673-54766695 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1149377343 17:56058577-56058599 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1149409439 17:56390188-56390210 AGGGGTGGGGGGCAAGGGGAGGG - Intronic
1149522884 17:57331363-57331385 CTGGGGAGGGGGCAGGGTGAGGG + Intronic
1149596720 17:57868590-57868612 CTTTGGAGGTGGCTAGGGGAGGG - Intronic
1149728865 17:58924718-58924740 GGGGGTGGGGGGCAAGGGGAAGG - Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150135168 17:62691362-62691384 CTTTGTAGTGGTCAAGGGCATGG + Intronic
1150229667 17:63543259-63543281 CTGAGGAGGGGGAGAGGGGATGG - Intronic
1150539414 17:66081012-66081034 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
1150747728 17:67829458-67829480 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1151004025 17:70412966-70412988 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1151085193 17:71372367-71372389 ATTTGGAGAGGGCAAGGGGAAGG - Intergenic
1151186770 17:72370560-72370582 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
1151198543 17:72450413-72450435 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1151756959 17:76080508-76080530 CAGGGTGCGGGGCAAGGGGAAGG + Intronic
1152134802 17:78497574-78497596 CTGTGCTGGGGGCAAGGGAGAGG + Intronic
1152449596 17:80368888-80368910 CTGAGAAGGGGGGAAGGGGAAGG - Intronic
1152892800 17:82892024-82892046 CTGTGCAGGGGGGAAGTGGGGGG - Intronic
1152902982 17:82955998-82956020 GAGGGTGGGGGGCAAGGGGAGGG + Intronic
1152982350 18:290340-290362 CGGGGTGGGGGGCAAGAGGAGGG + Intergenic
1153291593 18:3507018-3507040 GTGTGTATGGGGCAGGGGGTGGG + Intronic
1153360369 18:4188456-4188478 GGGTGTGAGGGGCAAGGGGAGGG - Intronic
1153391060 18:4560123-4560145 CAGGGTTGGGGTCAAGGGGAGGG - Intergenic
1153408350 18:4765876-4765898 GTGGGTGGGGGACAAGGGGAGGG - Intergenic
1153632718 18:7087487-7087509 CTGAGGAGTGGGCCAGGGGAAGG - Intronic
1153951802 18:10064076-10064098 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1154023820 18:10688147-10688169 GGGGGTAGGGGGCAAGGGGAGGG - Intronic
1154053766 18:10991371-10991393 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1154458996 18:14560704-14560726 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1155012681 18:21796391-21796413 CAGGGTGGGGGGCAAGGGGAGGG + Intronic
1155115740 18:22764792-22764814 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1155395818 18:25385787-25385809 CGGGGTTGGGGGAAAGGGGAGGG + Intergenic
1155619037 18:27754763-27754785 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1155651183 18:28143997-28144019 GTGGGTGGAGGGCAAGGGGAGGG + Intronic
1155711462 18:28885850-28885872 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1155812542 18:30255670-30255692 AAGTTTGGGGGGCAAGGGGAGGG + Intergenic
1155893842 18:31298690-31298712 TGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1155929549 18:31690989-31691011 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1156187825 18:34684289-34684311 CGGGATGGGGGGCAAGGGGAGGG - Intronic
1156231224 18:35155707-35155729 CAGTGATGGGGGCGAGGGGAAGG + Intergenic
1156374621 18:36502389-36502411 GTGGGTAGGGGGCTAGGGAAGGG - Intronic
1156501237 18:37559918-37559940 GTGTGTAGGGGGCATAGTGATGG + Intronic
1156517471 18:37693085-37693107 TGGGGTAGGGGGCAGGGGGAGGG - Intergenic
1156626365 18:38914857-38914879 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1156774098 18:40766178-40766200 CGGGGTTGGGGGCTAGGGGAGGG - Intergenic
1157142460 18:45123399-45123421 GTGTGGCGGGGGCAGGGGGATGG + Intergenic
1157327911 18:46682116-46682138 CTGGGGAGGGTGCAGGGGGAGGG + Intronic
1157379597 18:47201173-47201195 CTGTGTAGGGAGCAATGTAATGG + Intergenic
1157454022 18:47810286-47810308 GTGGGAAGGGGGCAAGGAGAAGG - Exonic
1157886556 18:51372824-51372846 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1158012822 18:52748468-52748490 CAGTGAACGGGGCAAGGGGTGGG + Intronic
1158620154 18:59025926-59025948 GGGGGTAGGGGGCAAGAGGAGGG + Intergenic
1158692642 18:59674469-59674491 GTGGGTAGGGGGCTAGGAGAGGG + Intronic
1158735058 18:60069750-60069772 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1158742062 18:60154290-60154312 GAGAGTTGGGGGCAAGGGGAGGG - Intergenic
1158767655 18:60474246-60474268 GGGTGTGGGGGACAAGGGGAGGG + Intergenic
1158787875 18:60738996-60739018 GGGGGTCGGGGGCAAGGGGAAGG + Intergenic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159321411 18:66855561-66855583 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
1159542043 18:69790266-69790288 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1159743748 18:72206729-72206751 CTGGGGAGTGGACAAGGGGAAGG + Intergenic
1161176383 19:2844801-2844823 CTGTGCAGTGGGCTAGGGGGTGG - Intronic
1161396682 19:4048245-4048267 CTGTGGACGGGGCACGGGGCGGG + Intronic
1161545599 19:4878365-4878387 CTGTGTTGGGGAAAAGGGGGTGG - Intergenic
1161595227 19:5147910-5147932 CTGTGTGGTGGCCAAGGAGATGG + Intronic
1161648539 19:5469663-5469685 CTGTGTAGGGGGAAAGTTGTCGG + Intergenic
1161981475 19:7632572-7632594 CTGTGTGGGGGTGAAGGGGTAGG - Intronic
1161990092 19:7679844-7679866 CTGTTACTGGGGCAAGGGGAGGG + Intronic
1162320563 19:9968780-9968802 CTGTGTGGGTGGTTAGGGGATGG + Intronic
1162435079 19:10653509-10653531 CTGTCAATGGGGGAAGGGGAAGG + Intergenic
1162523544 19:11195111-11195133 CTGGGTCGGGGGGAAGGGGTAGG + Intronic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163068792 19:14820398-14820420 GGGGGTCGGGGGCAAGGGGAGGG + Intronic
1163131210 19:15274362-15274384 GTGTGATGGGGTCAAGGGGAGGG + Intronic
1163137321 19:15321867-15321889 CTTTGTAGGGGGTAGGGTGAGGG - Intronic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163200938 19:15768610-15768632 TTGTGTAAGGGGGAAGGAGAAGG - Intergenic
1163352928 19:16790464-16790486 GGGGGTAGGGGGTAAGGGGAGGG + Intronic
1163720796 19:18897296-18897318 CTCGGTGTGGGGCAAGGGGAAGG - Intergenic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1164046476 19:21547035-21547057 GGGTGTGGGGGGCAATGGGAGGG - Intronic
1164163188 19:22644369-22644391 TGGAGTGGGGGGCAAGGGGAGGG - Intronic
1164177928 19:22793548-22793570 CTGTCAGAGGGGCAAGGGGAGGG - Intergenic
1164496895 19:28773854-28773876 CTGTGCTGGGGGCCAGGGGAAGG + Intergenic
1164701873 19:30290830-30290852 GTGGGTGGGGGGCAAAGGGAGGG - Intronic
1164706921 19:30326547-30326569 CTGAGGAGAGGGCCAGGGGATGG + Intronic
1164728132 19:30480548-30480570 TGGGGTAGGGGGCAAGGGGAGGG + Intronic
1164813490 19:31176265-31176287 CTGTGTAGGGGAGGAGGGGTGGG + Intergenic
1165038113 19:33049286-33049308 CTCTGTAGGGGACAAGGTGGCGG + Intronic
1165069380 19:33246999-33247021 CTGGGTGGGGGGCACTGGGATGG + Intergenic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165972448 19:39643336-39643358 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1166316199 19:41991569-41991591 CTGTGCAGGAGGCCAGGAGAGGG + Intronic
1166409500 19:42547167-42547189 CTGTGTCTGGGGGAAGGGGCTGG + Intronic
1166632682 19:44421020-44421042 GTGGGTGGAGGGCAAGGGGAGGG - Intronic
1166792995 19:45408930-45408952 CTTCGTAGGGGGCAGAGGGATGG - Exonic
1167107919 19:47441441-47441463 CTGTGCAGGGGGTAAGGGGGAGG + Intronic
1167275722 19:48538054-48538076 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1167397276 19:49238895-49238917 CAGGGGTGGGGGCAAGGGGAGGG - Intergenic
1167462155 19:49631161-49631183 CTCTGCAGGGGGCATGTGGATGG + Intergenic
1167639186 19:50671114-50671136 CTGGGTAGGGGGCAGGGTGCAGG - Intronic
1167900360 19:52617033-52617055 GGGGGTAGGGGGCAAGGGGAGGG + Intronic
1168184550 19:54690883-54690905 TTGGGTAGGGGGGTAGGGGAGGG + Intronic
1168381738 19:55929624-55929646 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
925041964 2:739513-739535 CTGTGCAGGAGGCAGGGGAATGG + Intergenic
925252203 2:2449229-2449251 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
925306138 2:2849264-2849286 CTGTGGAGGGGGCAGGCAGATGG - Intergenic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926379167 2:12267177-12267199 CTGGGTGGGGGACTAGGGGAGGG - Intergenic
926403868 2:12527988-12528010 GGGTGTTGGGGGCTAGGGGAGGG + Intergenic
926820171 2:16843367-16843389 CGGGGTGGGGGGCGAGGGGAGGG - Intergenic
926970079 2:18458350-18458372 ATGGGTTGGGGGCTAGGGGAGGG - Intergenic
927377963 2:22440627-22440649 CGGGGTTGGGGGCAAGGGGAGGG - Intergenic
927562865 2:24085664-24085686 CAGTGTAGGGGGTCAGTGGATGG - Intronic
927993548 2:27465582-27465604 CTGGTGATGGGGCAAGGGGAGGG + Intronic
928060947 2:28112348-28112370 GGGGGTAGGGGGCTAGGGGAGGG - Intronic
928220945 2:29402221-29402243 TTGTGTGGGGGGCCAGGGGCTGG + Intronic
928616429 2:33044255-33044277 GTGGGTAGGGGGCTAGGGGAGGG - Intronic
928699194 2:33881487-33881509 CTGTGCAGGGGGCAAGGAATGGG - Intergenic
928998369 2:37321473-37321495 GTGTGCATGGGGGAAGGGGAAGG - Intronic
929312616 2:40443104-40443126 AGGGGTTGGGGGCAAGGGGAGGG + Intronic
929637030 2:43533740-43533762 TTGGGTGGAGGGCAAGGGGAGGG + Intronic
929817009 2:45240541-45240563 CGGGGTAGGGGGCAAGGGGAGGG + Intergenic
929990275 2:46780859-46780881 CTGTGCAGTGAGCAAGGCGAGGG + Intergenic
929993692 2:46811806-46811828 AAGTGAGGGGGGCAAGGGGAAGG - Intergenic
930177923 2:48318954-48318976 CTGTGTTGGGAGCAAAGAGATGG - Intronic
930328636 2:49953856-49953878 GGGTGTGGGGGACAAGGGGAGGG + Intronic
930610099 2:53532808-53532830 TTGGGTCGGGGGCAAGGGGAGGG - Intronic
930630187 2:53745206-53745228 GTGTATATGGAGCAAGGGGAAGG + Intronic
930748203 2:54906387-54906409 CTGTGGAGGGGCCTGGGGGAAGG + Intronic
930870495 2:56166131-56166153 GTGGGTAGGGAGCTAGGGGAGGG + Intergenic
931014777 2:57964093-57964115 CTGTGTTGGGGGAGAGGGGAAGG - Intronic
931052351 2:58428592-58428614 CTGCGCCGGGGGCAAGAGGAGGG - Intergenic
931091398 2:58890566-58890588 GTGGATGGGGGGCAAGGGGAGGG - Intergenic
931215346 2:60236920-60236942 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
931363001 2:61594476-61594498 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
931432233 2:62217370-62217392 CAGGGTAGGGGGCACGGGGTGGG - Intronic
931587051 2:63840865-63840887 GTGTGGAGGTGGCAAGGGGCGGG - Intergenic
931873377 2:66485247-66485269 CGGGGTGGGGTGCAAGGGGAGGG - Intronic
931878631 2:66542370-66542392 CTGTGGAGGAGGCAAAGGGCTGG + Intronic
932380179 2:71275527-71275549 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
932428473 2:71658915-71658937 CTGTCTTGGGGGCATGGGGATGG - Exonic
932639358 2:73427628-73427650 CGGGGTAGGGGGTTAGGGGAGGG - Intronic
932911077 2:75806522-75806544 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
933035129 2:77386787-77386809 GGGAGTGGGGGGCAAGGGGAGGG + Intronic
933318334 2:80741505-80741527 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
933557430 2:83848596-83848618 GTGAGTCTGGGGCAAGGGGAGGG - Intergenic
933699314 2:85243448-85243470 CTGTGCAGGGTTCGAGGGGAAGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
933942350 2:87254992-87255014 CTGAGTAGGGGGGAGGGGTATGG - Intergenic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934602613 2:95669455-95669477 CTCTGTTGGGGGCCAGGGGCAGG - Intergenic
934656989 2:96121586-96121608 CTGTGTAACTGGCATGGGGAGGG - Intergenic
934698334 2:96416801-96416823 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
935484298 2:103633550-103633572 AGGTGTGGGGGGCTAGGGGAGGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936337876 2:111606577-111606599 CTGAGTAGGGGGGAGGGGTATGG + Intergenic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936701701 2:115018712-115018734 GGGTGTAAGGGGCTAGGGGAGGG + Intronic
936728611 2:115354691-115354713 TTGGGTGGGGGGCGAGGGGAGGG - Intronic
936850197 2:116886838-116886860 GGGAGTGGGGGGCAAGGGGAAGG + Intergenic
936967887 2:118145213-118145235 TGGGGTTGGGGGCAAGGGGAGGG - Intergenic
937101991 2:119278744-119278766 AGGAGTTGGGGGCAAGGGGAGGG + Intergenic
937111037 2:119367299-119367321 CTGTGTAGCGGGAGAGGGGTGGG + Intronic
937585528 2:123543302-123543324 CGGTGTTGGGGGCAAGGGGAAGG + Intergenic
937586066 2:123552330-123552352 GGGTGTTGGGGGCAAGGGGAAGG - Intergenic
937760172 2:125591180-125591202 GTGGGTAGGGGGCAAGAGGAGGG + Intergenic
937762903 2:125627392-125627414 CAGGGGAGGGGGCAAGGGTAGGG + Intergenic
937813159 2:126221295-126221317 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
937855127 2:126666692-126666714 GTGTGTAGGGAGGGAGGGGAGGG - Intronic
938036185 2:128036983-128037005 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
938036991 2:128043051-128043073 CTATCTAGGTGGGAAGGGGAAGG - Intergenic
938223965 2:129599426-129599448 GGGCGCAGGGGGCAAGGGGAGGG - Intergenic
938423785 2:131167245-131167267 CGGGGTGGGGGGCAAGTGGAGGG - Intronic
938598296 2:132811611-132811633 CTGTTGAGGGGGCAGGGGGCAGG - Intronic
939029026 2:137048049-137048071 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
939095136 2:137825607-137825629 GTGAGTAGTGGGAAAGGGGAAGG + Intergenic
939103850 2:137926686-137926708 AGGGGTTGGGGGCAAGGGGAGGG - Intergenic
939180927 2:138801932-138801954 GGGTGTCGGGTGCAAGGGGAGGG + Intergenic
939224379 2:139346570-139346592 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
939755358 2:146102876-146102898 GTGTGTAGGGGGCTAGGTCATGG + Intergenic
939841152 2:147188371-147188393 CGGGGTACGGGGCGAGGGGAGGG + Intergenic
939849203 2:147283695-147283717 CGGGGTTGGGGGCAAGGGAAGGG + Intergenic
939869987 2:147516182-147516204 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
939937205 2:148307782-148307804 GTGGGTCGGGGGCTAGGGGAGGG - Intronic
940083716 2:149834230-149834252 CAGGGTAGGGGGCTAGTGGAGGG - Intergenic
940194085 2:151073834-151073856 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
940240657 2:151559790-151559812 GGGAGTAGGGGGCTAGGGGAGGG + Intronic
940407519 2:153322643-153322665 GTGGGTGGGGAGCAAGGGGAGGG - Intergenic
940950468 2:159666928-159666950 GGGGGTGGGGGGCAAGGGGAAGG + Intergenic
940965079 2:159827956-159827978 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
941119861 2:161515646-161515668 CAGGGTGGGGGGCTAGGGGAGGG + Intronic
941196023 2:162453100-162453122 TGGGGTAGGGGGCAAGAGGAGGG - Intronic
941267276 2:163378295-163378317 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
941277146 2:163503690-163503712 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
941513840 2:166446873-166446895 GTGGGTAGGGGGCAAAGGAAGGG + Intronic
941822129 2:169854019-169854041 TGGGGTTGGGGGCAAGGGGAGGG + Intronic
942052452 2:172152752-172152774 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
942803396 2:179902077-179902099 GGGTGTGGTGGGCAAGGGGAGGG - Intergenic
942890427 2:180980863-180980885 CTGTGGGGGGGGGAAGGGGGGGG - Exonic
943001759 2:182336618-182336640 GCGGGTAGGGGGCTAGGGGAGGG + Intronic
943038963 2:182781108-182781130 CGGGGTAGGGGGCAAGGGGAAGG - Exonic
943147142 2:184060268-184060290 GTGGGTGGGAGGCAAGGGGAGGG - Intergenic
943163357 2:184283647-184283669 GGGTGTGGGGGGCAAGGTGAGGG - Intergenic
943170852 2:184396882-184396904 GGGGGTAGGGTGCAAGGGGAGGG + Intergenic
943240763 2:185380502-185380524 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
943443734 2:187955945-187955967 CAGAGTAGGGGACAAGGGGAGGG + Intergenic
943629711 2:190237813-190237835 CAGGGTAGGGGGCAAAGGGAGGG - Intronic
943635090 2:190297896-190297918 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
943885349 2:193210037-193210059 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
943973349 2:194440041-194440063 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
944109285 2:196114688-196114710 GGGGGTAGGGAGCAAGGGGAGGG - Intergenic
944168885 2:196752776-196752798 TGGAGTAGGGGGCTAGGGGAGGG - Intronic
944320780 2:198339443-198339465 CTGAAAAGGAGGCAAGGGGAGGG + Intronic
945140086 2:206676428-206676450 GGGGGTCGGGGGCAAGGGGAGGG + Intronic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
945210414 2:207376612-207376634 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
945350858 2:208777609-208777631 ATGGGTCGGGGGCTAGGGGAAGG - Intronic
945480975 2:210345428-210345450 TGGTGTAGGGGGCAAGGGGAGGG - Intergenic
945630867 2:212274913-212274935 GTGGGTAGGGGTCTAGGGGAGGG - Intronic
945874094 2:215258956-215258978 GTGTGGTGGGGGCAGGGGGAAGG + Intergenic
946188386 2:217994522-217994544 CTGGATATGGGGCATGGGGAGGG - Intronic
946395682 2:219442617-219442639 CTGGGTAGGTGTCAAGGGGGTGG - Intronic
946409954 2:219510928-219510950 CTGTGCAGGGGCCGAGGGGCGGG - Intergenic
946707223 2:222470115-222470137 CGGGGTGGGGGGCAAGGAGAGGG + Intronic
946900418 2:224366884-224366906 CAGTGGAGTGGGCAAAGGGAGGG + Intergenic
947302957 2:228708980-228709002 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
947739961 2:232480527-232480549 CTGGGTGGGGGGCAAGGGGGCGG - Intronic
947822466 2:233081674-233081696 CTCTGTAAGGGGTAAGGGGTGGG + Intronic
947946454 2:234107213-234107235 CGGGGTGGGGGTCAAGGGGAGGG + Intergenic
947984609 2:234437720-234437742 CTGTGCAGGGAGCAAGGGCTGGG - Intergenic
948017894 2:234704963-234704985 CTGCAGAGGGGGCAGGGGGAAGG + Intergenic
948461761 2:238133045-238133067 CTGACTAGGGCCCAAGGGGACGG + Exonic
948754191 2:240149731-240149753 CTGTGAAGGAGGCAAGGAGCTGG - Intergenic
1168881594 20:1210945-1210967 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1169172747 20:3478535-3478557 GTGGGTAGGGGGATAGGGGAGGG + Intronic
1169420733 20:5457246-5457268 GGGGGTCGGGGGCAAGGGGAGGG - Intergenic
1169749744 20:8979918-8979940 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1170486878 20:16826814-16826836 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1170517004 20:17140462-17140484 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1170518729 20:17160743-17160765 GTGGGTAGGGGGCTAGGGGAGGG + Intergenic
1170691710 20:18622224-18622246 GGGGGTCGGGGGCAAGGGGAGGG - Intronic
1170733356 20:18992777-18992799 CTGGGCAGGGGGCTAGGGAATGG - Intergenic
1170743084 20:19074881-19074903 CTGTGTAGGGTGCAGGGCAATGG + Intergenic
1170909018 20:20544870-20544892 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1171143035 20:22759459-22759481 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1171242520 20:23583145-23583167 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1171948196 20:31397163-31397185 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
1172029760 20:31973630-31973652 CTGTGTAGAGGTCTTGGGGAGGG + Intronic
1172228274 20:33319850-33319872 CTGGGCTGGGGGCAAGGGAAGGG + Intergenic
1172283984 20:33728112-33728134 CTGTGCAGGGGGGAATGGGAAGG + Intergenic
1172467213 20:35164886-35164908 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1172736500 20:37129890-37129912 AGGGGTGGGGGGCAAGGGGAGGG - Intronic
1172946106 20:38690682-38690704 GTGTGTTGGGGGGAGGGGGAAGG + Intergenic
1173121373 20:40292772-40292794 AGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1173296273 20:41761429-41761451 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1173479952 20:43390548-43390570 CTCTGAAGGGGGCATGGGGTGGG + Intergenic
1173549224 20:43920826-43920848 CTGTGGAGGGTGCACTGGGAGGG + Intronic
1173567155 20:44049641-44049663 GCGTTGAGGGGGCAAGGGGAGGG - Intronic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1174172665 20:48627194-48627216 CAGGGTAGGGGGCACGGGGTGGG + Intronic
1174670207 20:52299980-52300002 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1174873247 20:54202820-54202842 AGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1175450324 20:59060197-59060219 GGGGGCAGGGGGCAAGGGGAGGG + Intergenic
1175571892 20:60029626-60029648 CGGGGTGGGAGGCAAGGGGAAGG - Intronic
1175629703 20:60525083-60525105 GAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1175763339 20:61576011-61576033 CTGAGTAGGAGGAAAAGGGAGGG + Intronic
1175936792 20:62517813-62517835 CTGTGTTTGGGGCATGGGGGAGG - Intergenic
1175936829 20:62517921-62517943 CTGTGTGGGGGGCATGGGGGAGG - Intergenic
1175939792 20:62532703-62532725 CTGTGGAGGGGGCCATAGGAGGG + Intergenic
1175998635 20:62822224-62822246 CTGGGGAGGGGGAATGGGGAGGG - Intronic
1176111163 20:63411401-63411423 CTGTCCAGGGGGCACGGGCAGGG + Intronic
1176302841 21:5106987-5107009 CTGCGGTGGGGGCGAGGGGAAGG - Intergenic
1176923810 21:14722221-14722243 AGGGGTAGGAGGCAAGGGGAGGG - Intergenic
1177220393 21:18185164-18185186 AGGGGTAGGGGGCTAGGGGAGGG - Intronic
1177251585 21:18598631-18598653 GGGTGTCGGGGGCTAGGGGAGGG - Intergenic
1177313753 21:19430150-19430172 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1177403999 21:20642527-20642549 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
1177425708 21:20920939-20920961 TGGTGTCGGGGGCTAGGGGAGGG - Intergenic
1177442810 21:21149557-21149579 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1177705489 21:24698919-24698941 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1177780024 21:25612275-25612297 GGGTGTAGGGGGCTGGGGGAGGG - Intergenic
1178044976 21:28682896-28682918 CTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1178067927 21:28926728-28926750 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1178263828 21:31124352-31124374 CTGGGAAGGAGGCAAGGGCAAGG + Intronic
1178799307 21:35777597-35777619 GGGAGTAGGGGGCAAGGGGAGGG - Intronic
1178810325 21:35875927-35875949 GTGGGTAGGAGGAAAGGGGAGGG + Intronic
1178935238 21:36856059-36856081 GTGGGTGGGGGGCAGGGGGAAGG + Intronic
1179127985 21:38609032-38609054 CTTTCTTGGGGACAAGGGGATGG + Intronic
1179129754 21:38624293-38624315 GTGGGTGGGGGACAAGGGGAGGG + Intronic
1179236338 21:39550396-39550418 GTGGGTAGGGGACAAGGGGAGGG - Intergenic
1179311496 21:40199773-40199795 CGGTGGGTGGGGCAAGGGGAGGG + Intronic
1179514766 21:41898944-41898966 GTTTGTAGGGGACAAAGGGAAGG + Intronic
1179556354 21:42180005-42180027 GGGCGTGGGGGGCAAGGGGAGGG - Intergenic
1179854183 21:44154936-44154958 CTGCGGTGGGGGCGAGGGGAAGG + Intergenic
1180172380 21:46066337-46066359 CTGTGTTGGGGGCCGGGGGAAGG + Intergenic
1180570509 22:16712574-16712596 GTGGGTGGGGGGAAAGGGGAGGG + Intergenic
1180680450 22:17622498-17622520 CTGGGTGGGGAGCTAGGGGAGGG + Intronic
1181035950 22:20169807-20169829 CTGAGGAGGGGGCAGGGGCAAGG - Intergenic
1181186270 22:21107192-21107214 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1181434146 22:22900531-22900553 CCGTGTATGGGGCAAGGGCCTGG - Intergenic
1181435084 22:22905897-22905919 CCGTGTATGGGGCAAGGGCCTGG - Intergenic
1182785802 22:32906648-32906670 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1182867172 22:33613876-33613898 CTGTGTAAGGGGCCAGGAGAGGG - Intronic
1182949627 22:34360904-34360926 GTGGGTGGGGGGAAAGGGGAGGG + Intergenic
1183025767 22:35065010-35065032 AGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1183328418 22:37206699-37206721 CAGGGAGGGGGGCAAGGGGAAGG - Exonic
1183437330 22:37803622-37803644 CTGGGGAGGGGTAAAGGGGAGGG - Intergenic
1183447752 22:37870063-37870085 CTCTGGATGGGGCAAGGTGAGGG - Intronic
1183753179 22:39734037-39734059 GTGGGGAGGGGACAAGGGGAGGG - Intergenic
1184273378 22:43397230-43397252 CTGCGAGGGGTGCAAGGGGAGGG + Intergenic
1184300877 22:43559862-43559884 TTGGGTGGGGGGCAAGGGGAGGG + Intronic
1184355923 22:43979574-43979596 GTGTAGAGGGGGGAAGGGGAAGG - Intronic
1184420772 22:44381758-44381780 CAGTGTGGGGAGGAAGGGGAAGG + Intergenic
1184988046 22:48148838-48148860 CAGAGTGGGGGGCAGGGGGAAGG - Intergenic
1185083422 22:48722555-48722577 CGGGGTGGGGGGCTAGGGGAGGG + Intronic
1185240807 22:49744524-49744546 GAGGGTGGGGGGCAAGGGGAGGG + Intergenic
949119395 3:367781-367803 GGGTGTGGAGGGCAAGGGGAGGG - Intronic
949147424 3:719296-719318 GTGTTTTGGGGGCTAGGGGAGGG + Intergenic
949697751 3:6719090-6719112 GGGGGTGGGGGGCAAGGGGAAGG - Intergenic
949839420 3:8304060-8304082 CTGTGTTGGGTTAAAGGGGAAGG - Intergenic
950034734 3:9877259-9877281 CTGTGTGGTGGGCAAGGGTTGGG - Intronic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950263228 3:11556863-11556885 ATGTGTGCGGGGCAAGGAGAAGG + Exonic
950419940 3:12892716-12892738 CTGGGTAGGGTGCAAGGGCAGGG - Intergenic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950758219 3:15195580-15195602 CGGGGTGGGGGGCTAGGGGAAGG + Intergenic
950866606 3:16194824-16194846 CTGTTGTGGGGGCATGGGGAGGG + Intronic
950925475 3:16736686-16736708 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
951025305 3:17822102-17822124 GGGGGTAGGGGGCAAGGGGAGGG + Intronic
951059980 3:18194681-18194703 CATTGTAGGGGCCAGGGGGAGGG - Intronic
951653951 3:24983524-24983546 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
951765167 3:26189861-26189883 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
952009893 3:28888762-28888784 GTGGGTTGGGGGCTAGGGGAGGG - Intergenic
952037606 3:29221422-29221444 GGGTGTTGGGGGAAAGGGGAGGG - Intergenic
952126412 3:30305837-30305859 CTTTGAAAGGGGCAAGGGAAGGG + Intergenic
952284434 3:31954578-31954600 CTATATTGGGGGCAGGGGGAAGG + Intronic
952289912 3:32005218-32005240 GGGGATAGGGGGCAAGGGGAGGG - Intronic
952294901 3:32052802-32052824 AGGAGTTGGGGGCAAGGGGAGGG + Intronic
952364305 3:32661352-32661374 CGGGATCGGGGGCAAGGGGAGGG + Intergenic
952548953 3:34454239-34454261 GGGTGTGGGGGACAAGGGGAGGG - Intergenic
952640410 3:35587591-35587613 TTGAGTGGGGGGAAAGGGGAGGG - Intergenic
952676964 3:36044380-36044402 GGGTGTTGGGGGCTAGGGGAGGG - Intergenic
952847127 3:37697476-37697498 TGGGGTTGGGGGCAAGGGGAGGG - Intronic
953092038 3:39738139-39738161 TGGGGTGGGGGGCAAGGGGAAGG - Intergenic
953500065 3:43424663-43424685 GTGGGTAGGGGGCCAGGGAATGG - Intronic
953503268 3:43458799-43458821 AGGGGTAGGGGGAAAGGGGAGGG - Intronic
953888288 3:46732394-46732416 GAGGGTAGGGGGCAAGGGGAGGG - Intronic
953895480 3:46795911-46795933 GGGGGTTGGGGGCAAGGGGAGGG + Intronic
954135737 3:48581341-48581363 CTGTGGAGGAGGCAAGAGGGAGG + Intronic
954297466 3:49682217-49682239 CTGTCAAGGGGTCAAGGGGAAGG - Intronic
955024003 3:55149691-55149713 CTGTGTAGAAGGCATTGGGATGG - Intergenic
955092993 3:55770787-55770809 AGGGGTGGGGGGCAAGGGGAGGG - Intronic
955109282 3:55931602-55931624 GGGTGTGGGGGGCTAGGGGAGGG + Intronic
955429324 3:58826446-58826468 GAGTGTAGGGGGCTAGGGGAGGG - Intronic
955586682 3:60485651-60485673 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
955606125 3:60706244-60706266 GGGTTTGGGGGGCAAGGGGAGGG + Intronic
955721533 3:61886556-61886578 CAGTGGAGGTGGCAAGGGGCAGG - Intronic
955845889 3:63162309-63162331 GCGGGTAGGGGGCAAGGGCAGGG - Intergenic
956220757 3:66900129-66900151 GGGGGTAGGGGGCAAGAGGAGGG + Intergenic
956231618 3:67022812-67022834 CTGTCAGTGGGGCAAGGGGAGGG + Intergenic
956356363 3:68397302-68397324 GCGGGTAGGGGGCAAGGGGAGGG - Intronic
956382682 3:68682696-68682718 GTGGGTAGGGAGCTAGGGGAGGG - Intergenic
956570666 3:70690888-70690910 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
956669042 3:71669251-71669273 GGGGGTGGGGGGCAAGGGGAAGG + Intergenic
956836115 3:73097325-73097347 CTGTGCAGTAGGGAAGGGGAAGG + Intergenic
956918726 3:73903528-73903550 GTGGGTGGAGGGCAAGGGGAGGG - Intergenic
956974723 3:74566313-74566335 CTTTGAAGGGAGCAAAGGGAAGG + Intergenic
956984842 3:74686902-74686924 CGGGGTAGGGGGCTAGGGGAGGG - Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957250189 3:77762531-77762553 CTGGGTGCGGGGCTAGGGGAGGG + Intergenic
957264938 3:77950998-77951020 CTGTTTAGGAGGCTCGGGGAAGG - Intergenic
957276555 3:78097546-78097568 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
957466502 3:80599579-80599601 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
957578577 3:82040618-82040640 GGGAGTAGGGGGCTAGGGGAGGG + Intergenic
957803828 3:85120677-85120699 GGGGGTAGGGGGCCAGGGGAGGG + Intronic
958093027 3:88902342-88902364 AGGTGTGGGGGGCAAGGAGAGGG - Intergenic
958507437 3:94998344-94998366 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
958803329 3:98781328-98781350 CAGGGTTGGGGGCTAGGGGAGGG + Intronic
958951077 3:100416874-100416896 CTGGGTTAGGGGAAAGGGGAGGG - Intronic
958975852 3:100667320-100667342 CAGTGGTGGGGGCTAGGGGAGGG - Intronic
959001426 3:100968830-100968852 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
959176516 3:102919767-102919789 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
959394207 3:105816053-105816075 GGAGGTAGGGGGCAAGGGGAGGG + Intronic
959454301 3:106539891-106539913 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
959666042 3:108922813-108922835 GCGGGTAGGGGGCTAGGGGAGGG - Intronic
959693151 3:109220830-109220852 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
960015111 3:112878251-112878273 GAGGGTAGGGGGCTAGGGGAGGG + Intergenic
960125771 3:113996871-113996893 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
960643068 3:119847137-119847159 CGGGGTAGGGGGGAAGGGGGAGG + Intronic
960676684 3:120202297-120202319 GGGGGTTGGGGGCAAGGGGAGGG - Intronic
960745828 3:120887109-120887131 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
960750226 3:120941754-120941776 CAGTGAAGGGGGCAAATGGAAGG + Intronic
960828430 3:121817258-121817280 GGGGGTAGGGAGCAAGGGGAGGG + Intronic
960981101 3:123227456-123227478 AGGGGTTGGGGGCAAGGGGAGGG + Intronic
961311096 3:126001913-126001935 TGGGGTAGGGGGCAGGGGGAGGG + Intergenic
961359175 3:126356798-126356820 CAGTGTCGGGGGCAAGGGGGGGG - Intronic
961714195 3:128847568-128847590 CTGGGCAGGGAGGAAGGGGAAGG + Intergenic
961868877 3:129974440-129974462 GCGTGTAGGGGGCAAAGGGAGGG - Exonic
962064919 3:131969206-131969228 GGGAGTTGGGGGCAAGGGGAGGG + Intronic
962229555 3:133650359-133650381 GTGTGTGGGGGGCGGGGGGAGGG + Intronic
962330525 3:134473884-134473906 CTTTGTCGGGGGCAAAGTGAGGG - Intergenic
962671465 3:137713067-137713089 GGGTGGTGGGGGCAAGGGGAGGG + Intergenic
962741745 3:138367138-138367160 CTGTGGATGGGGCAAGGAAATGG + Intronic
963035935 3:141028914-141028936 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
963589174 3:147234989-147235011 CTGTCAGTGGGGCAAGGGGAGGG - Intergenic
963628694 3:147706983-147707005 CGGGGTTGGGGGCAAAGGGAGGG - Intergenic
964008883 3:151865831-151865853 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
964010625 3:151887422-151887444 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
964143241 3:153427883-153427905 GGGTGTGGGGGGCAAGGGGAAGG - Intergenic
964145958 3:153463549-153463571 GGGTGTCGGGGGTAAGGGGAGGG + Intergenic
964192797 3:154024564-154024586 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
964676560 3:159288869-159288891 CGGTGTATGGAGCATGGGGAGGG - Intronic
964844957 3:161035084-161035106 GGGGGTGGGGGGCAAGGGGAAGG + Intronic
964891181 3:161537534-161537556 GAGGGTAGGGGGCAAGGGAAGGG - Intergenic
965231445 3:166058386-166058408 TTGGGTGGGGAGCAAGGGGAGGG + Intergenic
965264032 3:166518123-166518145 CAGTGTTGGGGGCTGGGGGAGGG - Intergenic
965618125 3:170615453-170615475 GGGGGTTGGGGGCAAGGGGAGGG - Intronic
965790417 3:172381611-172381633 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
965800658 3:172490611-172490633 GGGAGTGGGGGGCAAGGGGATGG - Intergenic
965890291 3:173505044-173505066 GTGTGGCGGGGGCAAGGGGTGGG - Intronic
966101728 3:176277556-176277578 GGGTGTGAGGGGCAAGGGGAGGG - Intergenic
966255768 3:177914885-177914907 GTGGGTAGGGGGCGAGAGGAGGG + Intergenic
966280365 3:178219630-178219652 CAGGGTTGGGGGCAAGGGGAGGG - Intergenic
966892521 3:184417646-184417668 CTGTGTAGGGGTCCAGGACATGG - Intronic
966894469 3:184433196-184433218 GTGGGTGGGGGGAAAGGGGAGGG - Intronic
967052999 3:185802013-185802035 AGCAGTAGGGGGCAAGGGGAGGG + Intronic
967122230 3:186392365-186392387 CTGTGTATGGGGCCTGGGAAAGG - Intergenic
967198747 3:187052438-187052460 TGGGGTTGGGGGCAAGGGGAGGG - Intronic
967311234 3:188108287-188108309 TGGGGTAGGGGGCAGGGGGAGGG - Intergenic
967589636 3:191258491-191258513 GGGCGTAGGAGGCAAGGGGAGGG + Intronic
967706528 3:192657480-192657502 TAGTGTAGGGGGAGAGGGGAGGG + Intronic
967707271 3:192665605-192665627 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
967788915 3:193526453-193526475 CAGGGTGGGGAGCAAGGGGAGGG + Intronic
967820240 3:193833276-193833298 CTGGGTTGGGGGCAGGGAGAAGG + Intergenic
967857091 3:194126446-194126468 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
968095883 3:195930604-195930626 GGGGGTTGGGGGCAAGGGGAAGG - Intergenic
968233556 3:197017966-197017988 CTGAGCAGGGGGCAGGGGGCAGG + Intronic
968262053 3:197333466-197333488 GGGTGTCGGGGGCAAGGGGAGGG - Intergenic
968647873 4:1749164-1749186 GTGGGGAGGGGGCAGGGGGAGGG - Intergenic
968827361 4:2908907-2908929 CTGTGTAAGGCGCTAGGAGAGGG + Intronic
968977035 4:3827478-3827500 GTGTGTCGGGGCCAAGGGGTGGG + Intergenic
969064482 4:4467505-4467527 ATGTGTGGTGGGCAAGGGCAAGG + Intronic
969300735 4:6295470-6295492 CAGTGTAGGGGGCAGTGGGGCGG + Intronic
969739095 4:9011299-9011321 AGGGGTAGGGGACAAGGGGAAGG - Intergenic
970137687 4:12943943-12943965 GTGGGTAGAGGGCAAGGGGAGGG - Intergenic
970174667 4:13327109-13327131 GAGGGTTGGGGGCAAGGGGAGGG + Intergenic
970428366 4:15965618-15965640 CTGTGAAGGTGGCAGGGAGAAGG - Intronic
971181448 4:24331925-24331947 AGGGGTTGGGGGCAAGGGGAGGG - Intergenic
971466603 4:26970385-26970407 GGGGGTAGGGGGCTAGGGGAGGG - Intronic
971548277 4:27914899-27914921 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
971692791 4:29859058-29859080 CTGTGTGTGGTGCAAGGGGTTGG - Intergenic
971798105 4:31254659-31254681 AAGGGTAGGGGGCAAGGGGAGGG + Intergenic
971807932 4:31384700-31384722 CGGGGTAGGGGGAAAGGGGAGGG - Intergenic
971871198 4:32241283-32241305 GTGGGTGGGGGGAAAGGGGAGGG + Intergenic
971899168 4:32635955-32635977 TGGGGTTGGGGGCAAGGGGAGGG + Intergenic
971964289 4:33531904-33531926 GGGGGTAGGGGGCCAGGGGAAGG - Intergenic
971971792 4:33630521-33630543 CAGGGTCGGGGGCTAGGGGAGGG + Intergenic
972032581 4:34479698-34479720 GAGGGTAGGGGGCAAAGGGAGGG + Intergenic
972075770 4:35084616-35084638 CGGGGTGGGGGGCTAGGGGAGGG - Intergenic
972093929 4:35324826-35324848 TGGGGTAGGGGGAAAGGGGAGGG - Intergenic
972131149 4:35835059-35835081 CTCTGTATTCGGCAAGGGGAAGG - Intergenic
972184446 4:36511784-36511806 CGGGGTGGGGGGCCAGGGGAGGG + Intergenic
972260847 4:37407068-37407090 CAGGGTGGGGGGCTAGGGGAAGG + Intronic
972269404 4:37495706-37495728 CGGGGTTGGGGGCAAGGGGAGGG + Intronic
972358933 4:38308911-38308933 CTTTGAAGGGGGAAAAGGGAGGG - Intergenic
972424122 4:38916658-38916680 GGGGGTAGGGGGCAAGGGGAGGG + Intronic
972660988 4:41116314-41116336 GTGGGTGGGGGGCCAGGGGAGGG + Intronic
972698999 4:41475713-41475735 GAGGGTGGGGGGCAAGGGGAGGG + Intronic
972722289 4:41712062-41712084 AGGGGTCGGGGGCAAGGGGAAGG + Intergenic
972760847 4:42102416-42102438 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
973031624 4:45348977-45348999 CAGGGTTGGGGGCAAAGGGAAGG + Intergenic
973322363 4:48823394-48823416 GGGGGTAGGGGGCAAAGGGAGGG + Intronic
973589352 4:52425053-52425075 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
973920791 4:55682812-55682834 GGGGGTAGGGGGCTAGGGGAAGG - Intergenic
973922310 4:55700360-55700382 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
973995055 4:56450171-56450193 CAGGGTGGGGAGCAAGGGGAGGG + Intronic
974162301 4:58155570-58155592 TGGGGTAGGGGGCTAGGGGAGGG + Intergenic
974851163 4:67406507-67406529 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
974940159 4:68457932-68457954 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
975067514 4:70086407-70086429 GCGGGTAGGGGGCTAGGGGAGGG - Intergenic
975138726 4:70899412-70899434 GGGGGTGGGGGGCAAGGGGAAGG - Intergenic
975192262 4:71478608-71478630 GGGGGTTGGGGGCAAGGGGAGGG + Intronic
975221914 4:71822168-71822190 ATGGGTAGGGGGCAAGGGAGTGG - Intergenic
975235013 4:71984203-71984225 AGGGGTTGGGGGCAAGGGGAGGG - Intergenic
975241235 4:72061783-72061805 CGGGGTGGGAGGCAAGGGGAGGG + Intronic
975309754 4:72890551-72890573 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
975458506 4:74622522-74622544 CTGTGTAGGGAGCTGGGGGTTGG - Intergenic
975487634 4:74951580-74951602 CGGGGTTGGGGGCTAGGGGAGGG - Intronic
975526001 4:75351252-75351274 TTGGGTAGGGGGTGAGGGGAGGG - Intergenic
975775426 4:77781180-77781202 GGGGGTAGGGGGCAAGGGGAGGG + Intronic
975792923 4:77974019-77974041 GTGGGTAGGGGGCTGGGGGAGGG + Intergenic
975902382 4:79168011-79168033 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
976248130 4:83023946-83023968 TGATGTGGGGGGCAAGGGGAAGG + Intergenic
976832049 4:89326615-89326637 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
976919261 4:90417048-90417070 GTGGGTTGGGGGCAAGAGGAGGG + Intronic
976956153 4:90902881-90902903 CAGGGGAGGGGACAAGGGGATGG + Intronic
977297694 4:95229268-95229290 CGGGGTGGGGGGCTAGGGGAGGG - Intronic
977316036 4:95449006-95449028 ATGTGTGGGGAGTAAGGGGAAGG - Intronic
977360537 4:95998890-95998912 ATGTCTAGGGGGGAGGGGGAAGG + Intergenic
977426102 4:96868855-96868877 GGGGGTAGAGGGCAAGGGGAGGG + Intergenic
977625169 4:99182065-99182087 AAGAGTTGGGGGCAAGGGGAGGG - Intergenic
977677172 4:99760824-99760846 CGGGGTTGGGGGCTAGGGGAGGG - Intergenic
977888433 4:102278996-102279018 TGGGGTGGGGGGCAAGGGGAGGG + Intronic
978051425 4:104204856-104204878 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
978090851 4:104712798-104712820 GGGAATAGGGGGCAAGGGGAAGG + Intergenic
978112892 4:104984348-104984370 CTATGTAGGGGGCCAGGGGGAGG + Intergenic
978268982 4:106865115-106865137 GTGGGTAGGGGTCATGGGGAGGG - Intergenic
978438292 4:108708985-108709007 CGGGGTAGGGGGCTAGGTGAGGG + Intergenic
978452727 4:108853657-108853679 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
978517061 4:109580020-109580042 TGGGGTGGGGGGCAAGGGGAGGG - Intronic
978664841 4:111170024-111170046 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
978692570 4:111532924-111532946 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
979180972 4:117726617-117726639 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
979302223 4:119100190-119100212 CGGGGGAGGGGGCTAGGGGAGGG - Intergenic
979635938 4:122954257-122954279 CTGTCTATGGGACACGGGGATGG - Intronic
979711890 4:123789654-123789676 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
980168324 4:129255095-129255117 TGGAGTGGGGGGCAAGGGGAAGG - Intergenic
980239118 4:130150241-130150263 GTGGGTTGGGGGCTAGGGGAGGG - Intergenic
980380376 4:132006062-132006084 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
980508056 4:133748268-133748290 CGGGGCAGGGGGTAAGGGGAGGG + Intergenic
980832736 4:138151689-138151711 GGGAGTAGGGGGCAAAGGGAGGG - Intergenic
980861289 4:138502328-138502350 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
980865836 4:138552882-138552904 AGGGGTGGGGGGCAAGGGGAGGG + Intergenic
981035072 4:140161055-140161077 GCGGGTGGGGGGCAAGGGGAAGG - Intergenic
981294412 4:143114719-143114741 CGGGGTGGGGGACAAGGGGAGGG + Intergenic
981351604 4:143736283-143736305 CACTGTGGGGGGTAAGGGGAGGG + Intergenic
981430612 4:144654670-144654692 CTGTGCTGGGGGCAGGGGCAGGG - Intronic
981443946 4:144813013-144813035 GTGGGTAGGGGGAAAGGGGAGGG + Intergenic
981589288 4:146339968-146339990 CGGGGTGGGGGACAAGGGGAGGG - Intronic
981661365 4:147170723-147170745 TTGCGTGGGGGGAAAGGGGAGGG + Intergenic
981924429 4:150122603-150122625 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
982016733 4:151162140-151162162 GGGAGTTGGGGGCAAGGGGAGGG - Intronic
982455409 4:155603706-155603728 CAGTGTGTGGGGCAGGGGGACGG + Intergenic
982528829 4:156511873-156511895 GGGTGTGGCGGGCAAGGGGAGGG + Intergenic
982732796 4:158974449-158974471 GCGGGTGGGGGGCAAGGGGATGG - Intronic
982846576 4:160260248-160260270 GGGAGTTGGGGGCAAGGGGAAGG - Intergenic
982883760 4:160751605-160751627 GTGTGTTGGGGACTAGGGGAGGG + Intergenic
982988412 4:162239495-162239517 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
983103851 4:163660403-163660425 GTGGGTGGGGGTCAAGGGGAGGG + Intronic
983179998 4:164636502-164636524 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
983291757 4:165816061-165816083 AGGGGTAGGGGGCTAGGGGAGGG - Intergenic
983324276 4:166233491-166233513 CTGGGTAGGTGGCATGTGGACGG + Intergenic
983526250 4:168763023-168763045 TGGGGTAGGGGGCAAAGGGAGGG + Intronic
983860026 4:172694285-172694307 GGGTATTGGGGGCAAGGGGAGGG - Intronic
984153125 4:176159423-176159445 ATGTGAAGGGAGAAAGGGGATGG - Intronic
984328928 4:178290517-178290539 CGGGGTGGGGGGCAAGGGGAGGG + Intergenic
984594643 4:181653854-181653876 CTGGGTCGGGGGAAAGGGGAGGG - Intergenic
984619216 4:181933014-181933036 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
984702992 4:182830276-182830298 CTGTGCAGGAGGCAAAGGGCAGG - Intergenic
985044548 4:185927428-185927450 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
985095338 4:186407537-186407559 CTGTGTGTGGGGGAAAGGGAAGG + Intergenic
985196680 4:187437851-187437873 GTGTGTAGGAGGCTAGGGAATGG + Intergenic
985352191 4:189076116-189076138 GGGTGTAGGGGGCAAGGGGAGGG + Intergenic
985567082 5:624425-624447 CTGTGCAGGTGGCAAGCGGCGGG - Intronic
985678477 5:1244174-1244196 GGGTGTGGGGGGTAAGGGGATGG - Intronic
985826866 5:2198839-2198861 AGGGGTTGGGGGCAAGGGGAGGG - Intergenic
985872246 5:2566075-2566097 TGGCGTGGGGGGCAAGGGGAGGG + Intergenic
985968229 5:3353767-3353789 CTTTGCAGGGGGCAAATGGATGG + Intergenic
986051991 5:4098778-4098800 CTGTCTAGGAGCCAAGGAGAGGG + Intergenic
986071459 5:4288618-4288640 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
986118871 5:4811522-4811544 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
986518388 5:8587079-8587101 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
986527855 5:8700034-8700056 GTGGGTAGGGAGCTAGGGGAGGG + Intergenic
986665295 5:10097292-10097314 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
986825525 5:11517622-11517644 GGGTGTAGGGGGCAAGGGGAGGG + Intronic
987353670 5:17043584-17043606 CTTTGTCTGGAGCAAGGGGAAGG - Intergenic
987420559 5:17715373-17715395 CAGGGTAGGAGGCAAGGAGAGGG - Intergenic
987665637 5:20935518-20935540 CTTTGAAGGGGGAAAGGGAACGG - Intergenic
987710816 5:21499127-21499149 CTGGGGAGGGGACAAGGGGCTGG - Intergenic
987773263 5:22333315-22333337 GGGGGTAGGGGGCAATGGGAGGG + Intronic
987800842 5:22694981-22695003 GTGGGTTGGGGGCAAGGGGAGGG - Intronic
987852372 5:23373199-23373221 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
988377462 5:30455773-30455795 GGGCGTTGGGGGCAAGGGGAGGG - Intergenic
988757059 5:34266652-34266674 CTTTGAAGGGGGAAAGGGAACGG + Intergenic
988783175 5:34541912-34541934 GTGGGCAGGGGGCAAGGGAAGGG + Intergenic
989078105 5:37586550-37586572 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
989194764 5:38705900-38705922 CGGGTTCGGGGGCAAGGGGAGGG + Intergenic
989260747 5:39417147-39417169 CTGGTTGGGGGGTAAGGGGAGGG + Intronic
989487665 5:42011017-42011039 CTGGGTTGGGGGCTAGGGGAGGG - Intergenic
989507840 5:42247897-42247919 CTGTATAGGAGGCATGGTGAGGG + Intergenic
989630314 5:43475375-43475397 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
989690607 5:44138625-44138647 GTGTGTTGGGGGGAGGGGGAGGG + Intergenic
989697696 5:44222820-44222842 GGGGGTGGGGGGCAAGGGGACGG + Intergenic
989737985 5:44731589-44731611 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
990062806 5:51672994-51673016 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
990536209 5:56725241-56725263 GTGAGTAGGGGGCTAGGGGAGGG + Intergenic
990717376 5:58653115-58653137 GAGGGTGGGGGGCAAGGGGAGGG - Intronic
990941177 5:61204600-61204622 TGGGGTAGGGGGCAGGGGGAAGG + Intergenic
991040585 5:62171256-62171278 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
991110185 5:62891013-62891035 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
991182391 5:63767614-63767636 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
991400708 5:66248507-66248529 GAGGGTTGGGGGCAAGGGGAGGG - Intergenic
991596448 5:68311538-68311560 CTGGGAAGTGGGCAGGGGGAAGG + Intergenic
991749033 5:69779388-69779410 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
991761156 5:69918185-69918207 CTGGGGAGGGGACAAGGGGCTGG - Intergenic
991786173 5:70199915-70199937 CTGGGGAGGGGACAAGGGGCTGG + Intergenic
991840384 5:70793235-70793257 CTGGGGAGGGGACAAGGGGCTGG - Intergenic
991878617 5:71200301-71200323 CTGGGGAGGGGACAAGGGGCTGG + Intergenic
991892973 5:71358639-71358661 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
992053036 5:72958355-72958377 TTGTGTATGGTGCAAGGGAAAGG + Intronic
992603173 5:78425937-78425959 AGGGGTGGGGGGCAAGGGGAGGG - Intronic
992624142 5:78621864-78621886 CAGCTTAGGGGGAAAGGGGAAGG - Intronic
992700244 5:79334451-79334473 TTGTGTTGGGGGTGAGGGGAAGG + Intergenic
992891888 5:81211310-81211332 CTAGGTAGGTGGGAAGGGGAGGG - Intronic
993035386 5:82750505-82750527 GGGGGTTGGGGGCAAGGGGAAGG - Intergenic
993467290 5:88264933-88264955 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
993764064 5:91833573-91833595 GGGTGTGGGGGGAAAGGGGAGGG - Intergenic
993778259 5:92030132-92030154 GAGGGTAGGGGGCAAGGGGAGGG + Intergenic
993897188 5:93549965-93549987 AGGGGTTGGGGGCAAGGGGAGGG + Intergenic
994146010 5:96395641-96395663 GGGAGTAGGGGGCAAGGGGAGGG + Intronic
994584740 5:101692532-101692554 CTGGGTATTGGGCAAGGGGAGGG - Intergenic
994595709 5:101831850-101831872 GTGGGTGGGAGGCAAGGGGAGGG - Intergenic
994687091 5:102969088-102969110 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
995087043 5:108123307-108123329 CTGTGTTGGGGGCAAAGAAAAGG - Intronic
995186174 5:109273310-109273332 GGGTGCAGGGGGCTAGGGGAGGG + Intergenic
995211435 5:109543974-109543996 GGGTGTGGGGGGCTAGGGGATGG + Intergenic
995252006 5:110004659-110004681 ATGGGTGGGGGGCAAGGGGAGGG - Intergenic
995423714 5:111995063-111995085 GGGTGTGGGGGGCTAGGGGAGGG + Intronic
995593472 5:113724111-113724133 GGGGGTGGGGGGCAAGGGGAAGG - Intergenic
995785429 5:115822707-115822729 GTGGGTTGGGGGCAAGGGGAGGG - Intergenic
995946110 5:117648352-117648374 GTGGGTGGGGAGCAAGGGGAGGG - Intergenic
995996999 5:118312559-118312581 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
996182633 5:120438200-120438222 CGGGGTGGGGGGCAAGGGGAGGG + Intergenic
996250719 5:121328324-121328346 GTGGGTTGGGGGCTAGGGGAGGG - Intergenic
996297443 5:121938381-121938403 CGGTGTGGGGGACGAGGGGAAGG - Intergenic
996422826 5:123280870-123280892 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
996426087 5:123314669-123314691 CAGGGTTGGGTGCAAGGGGAGGG - Intergenic
996474720 5:123903817-123903839 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
996677839 5:126197038-126197060 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
996786848 5:127246454-127246476 CGGGGTGGGGAGCAAGGGGAGGG + Intergenic
996960991 5:129249432-129249454 CAGGGTAGGAGGCAAGGGGACGG + Intergenic
997089553 5:130841380-130841402 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
997112979 5:131095572-131095594 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
997117726 5:131143880-131143902 CTGGGTTGAGGGCAAGGGGAGGG + Intergenic
997369150 5:133346242-133346264 GGGGGTTGGGGGCAAGGGGAGGG + Intronic
997519401 5:134512860-134512882 CTGGGAAGGGGGGAAGGGCAGGG - Intergenic
997800623 5:136857320-136857342 CGGGGTGGGAGGCAAGGGGAGGG + Intergenic
997858049 5:137391048-137391070 GGGGGTTGGGGGCAAGGGGAGGG - Intronic
997867965 5:137481592-137481614 CTCTGTAGTGGGGAAGGGAATGG + Intronic
997938823 5:138138315-138138337 CTGTAAAGGGGTCAAGGGAAAGG + Intronic
998152782 5:139766487-139766509 CTGTGTATGGGGGAAATGGATGG + Intergenic
998564399 5:143203918-143203940 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
998645804 5:144060534-144060556 GTGTGTTGGGGTCAAGGGGAGGG + Intergenic
998674372 5:144390668-144390690 GGGGGTAGGGGGCAAGGGGAGGG - Intronic
998684227 5:144505719-144505741 GTGTGGTGGGGGGAAGGGGAAGG + Intergenic
998976320 5:147652850-147652872 AGGTGGTGGGGGCAAGGGGAGGG - Intronic
999011675 5:148048458-148048480 GGGTGTTGGGGGCAAGGGGAGGG + Intronic
999688975 5:154128824-154128846 TGGGGTAGGGGGCAAGAGGAGGG + Intronic
999737120 5:154521230-154521252 CTCTGGAGGGAGCAGGGGGATGG - Intergenic
999746010 5:154592432-154592454 GGGTGTAGGGGGCAAGAGGAGGG - Intergenic
999943070 5:156565687-156565709 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
1000291166 5:159872916-159872938 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1000421210 5:161039903-161039925 GTGGGTAGGGGGCAAGGGGAGGG + Intergenic
1000421260 5:161040368-161040390 GTGGGTAGGGGGCAAGGGGAGGG + Intergenic
1000579576 5:163018698-163018720 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1000593075 5:163182139-163182161 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1000759815 5:165208139-165208161 CTGGGGAGGGGTCAGGGGGAAGG + Intergenic
1000786379 5:165549595-165549617 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1000964359 5:167637812-167637834 GTGGGTTGGGGGAAAGGGGAGGG + Intronic
1001056916 5:168457430-168457452 CTGTGGAGGGGGCAGGGTGGAGG - Intronic
1001148944 5:169209795-169209817 GGGGGTAGGGGGCAAGGGGAGGG + Intronic
1001269739 5:170302305-170302327 CTGTGTGTGGGGCTGGGGGAAGG + Intergenic
1001585552 5:172831832-172831854 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1001645270 5:173276697-173276719 CAGGGTGAGGGGCAAGGGGAGGG + Intergenic
1002541526 5:179908967-179908989 CTGGCTAGAGGGCAAAGGGAAGG + Intergenic
1002686740 5:181017818-181017840 GGGTGGAGGGGGAAAGGGGAGGG + Intergenic
1002716680 5:181232473-181232495 CTGTGCTGGGAGCAAGGGGGTGG + Intronic
1003109497 6:3241732-3241754 TGGGGTGGGGGGCAAGGGGAGGG - Intronic
1003191742 6:3880693-3880715 CTGTGTGGGGGACAAGGTGCAGG - Intergenic
1003261420 6:4519714-4519736 GAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1003458339 6:6305659-6305681 CTCTGTAGGAGGCAGGGGTAGGG + Intronic
1003963147 6:11228060-11228082 GTGTGTGGGAGGCAAGGGGGCGG + Intronic
1003999856 6:11587610-11587632 GTGGGTGGGGGGCAAGGGAAGGG - Intergenic
1004231243 6:13835424-13835446 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1004326494 6:14678751-14678773 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1004370903 6:15051416-15051438 CTGGGCAGGTGGCGAGGGGAGGG - Intergenic
1004535897 6:16501465-16501487 GTGAGTGGGGGGCAAGGGGAGGG - Intronic
1004794155 6:19062621-19062643 GCGGGTAGGGGGCAAGGGGATGG - Intergenic
1004809533 6:19244451-19244473 GTGGGTGGGGCGCAAGGGGAGGG + Intergenic
1004854835 6:19738654-19738676 AGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1004993062 6:21160856-21160878 GAGAGTGGGGGGCAAGGGGAGGG - Intronic
1005145935 6:22690111-22690133 GAGGGTAGGGGGCTAGGGGAGGG + Intergenic
1005193207 6:23252198-23252220 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1005223403 6:23614191-23614213 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1005546871 6:26881376-26881398 CTGGGGAGGGGACAAGGGGCTGG + Intergenic
1005772790 6:29092821-29092843 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1005773542 6:29103146-29103168 GTGTGTAGGGGGAGCGGGGAGGG + Intergenic
1005796371 6:29366153-29366175 GGGAGTAGGTGGCAAGGGGAGGG + Intronic
1005869515 6:29964106-29964128 GAGGGTAGGGGGCTAGGGGAGGG + Intergenic
1005986242 6:30877423-30877445 GTGTGTATGGGGGATGGGGATGG + Intronic
1006630617 6:35427487-35427509 CTGAGTAAAGGGGAAGGGGAGGG - Exonic
1006669176 6:35719030-35719052 GTTGGGAGGGGGCAAGGGGAGGG - Intronic
1007094043 6:39202462-39202484 CTGGGGAAGGGGCAAGGTGAGGG + Intronic
1007224446 6:40303053-40303075 GTGTGGAGGCGGCAAGGAGAGGG - Intergenic
1007380416 6:41486840-41486862 GTGTGCTGGGGCCAAGGGGAGGG + Intergenic
1007418892 6:41707543-41707565 CTGGGGTGGGGGCTAGGGGAAGG - Intronic
1007600481 6:43077717-43077739 CTTTGAAGGTGGCAATGGGAAGG + Intronic
1007737013 6:43988047-43988069 CAGTGTCTGGGGCAAGGGAAGGG - Intergenic
1007790249 6:44304571-44304593 CTGAGTGGGAGCCAAGGGGAGGG - Intronic
1008311824 6:49985683-49985705 GGGCGTAGGGGGCAAGGGGAGGG - Intergenic
1008424671 6:51343421-51343443 GTGTGTGGGGGGCTAGAGGAGGG - Intergenic
1008837845 6:55858967-55858989 GCGAGTAGGGGGCAAAGGGAGGG + Intronic
1009017626 6:57922458-57922480 CTGGGGAGGGGACAAGGGGCTGG + Intergenic
1009376549 6:62978197-62978219 CGGGGTGGAGGGCAAGGGGAGGG - Intergenic
1009449679 6:63786534-63786556 AGGGGTGGGGGGCAAGGGGAGGG + Intronic
1009459327 6:63893576-63893598 GTGGTTGGGGGGCAAGGGGAGGG + Intronic
1009507120 6:64498614-64498636 GTGGGTGGGGGGAAAGGGGAGGG - Intronic
1009656145 6:66546920-66546942 ATGTGTTGGGGGCAGAGGGAGGG + Intergenic
1010026110 6:71219344-71219366 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1010224438 6:73475943-73475965 TTGTGTAATGGGCAAGGGGGCGG - Intronic
1010375455 6:75163512-75163534 TAGGGTAGGGGGCTAGGGGAGGG + Intronic
1010616730 6:78021780-78021802 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1010624118 6:78114793-78114815 CTGTTGGGGGGACAAGGGGAGGG + Intergenic
1010959822 6:82133105-82133127 GAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1011020090 6:82803388-82803410 TGGGGTAGGGGGCAAGGAGAAGG - Intergenic
1011028802 6:82898677-82898699 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
1011284573 6:85709136-85709158 CGGGGTGGGGGGCTAGGGGAGGG - Intergenic
1011339140 6:86293293-86293315 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1011713862 6:90084093-90084115 GTGTGTGGGAGGGAAGGGGAGGG + Intronic
1011825058 6:91296262-91296284 GGGGGTAGGAGGCAAGGGGAGGG - Intergenic
1011828546 6:91340182-91340204 GTGGGTTGGGGGCTAGGGGAGGG + Intergenic
1011886072 6:92097067-92097089 GGGAGTAGGGGGCTAGGGGATGG + Intergenic
1011975551 6:93292218-93292240 ATAAGTTGGGGGCAAGGGGAGGG - Intronic
1012082520 6:94779573-94779595 GTGGGTAGGGGGCAAGGGGAGGG - Intergenic
1012230310 6:96753087-96753109 ATGGGTGGGAGGCAAGGGGAGGG + Intergenic
1012487075 6:99734375-99734397 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1012686383 6:102255856-102255878 CTGTTGTGGGGACAAGGGGAGGG - Intergenic
1012756306 6:103235810-103235832 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1012790101 6:103682408-103682430 GTGTGTAGGGGGGTGGGGGAAGG - Intergenic
1012871436 6:104677052-104677074 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
1012974242 6:105762916-105762938 GGGAGTAGGGGGCTAGGGGAGGG + Intergenic
1013019931 6:106204077-106204099 GGGAGTAGGGGGCTAGGGGAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013453312 6:110306156-110306178 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1013608737 6:111774560-111774582 GTGTGTGGGGGGGATGGGGAGGG - Intronic
1013651632 6:112200882-112200904 GTGGGTGGGGGGCAAGGGGAGGG + Intronic
1013745052 6:113335436-113335458 GTGGGTTGAGGGCAAGGGGAGGG - Intergenic
1013973325 6:116046631-116046653 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
1014043542 6:116856863-116856885 GTGGGTTGGGGGCTAGGGGAGGG - Intergenic
1014113921 6:117651528-117651550 ATGGGTGGGGGGCAAGGGAAGGG + Intergenic
1014224649 6:118834017-118834039 CTGGGTGGGGGGCTAGGGGAGGG - Intronic
1014237036 6:118969788-118969810 CGGGGTGGGGGGCAGGGGGAGGG - Intronic
1014332326 6:120085504-120085526 ATGGGGAGGGGGCAGGGGGAAGG - Intergenic
1014352959 6:120366722-120366744 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1014422866 6:121266911-121266933 GTGGGGAAGGGGCAAGGGGAGGG + Intronic
1014459062 6:121673572-121673594 ATGTGAAGGGAGCAAGGGGAAGG - Intergenic
1014597372 6:123361372-123361394 GTGGGTGGGGGGCAAAGGGAGGG + Intronic
1014671333 6:124308132-124308154 CGGGGTGGGGGGCAAAGGGAGGG - Intronic
1014731437 6:125036067-125036089 GGGGGTAGGGGGCAAGGGGAGGG - Intronic
1014754203 6:125285164-125285186 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1014960637 6:127679662-127679684 AGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1014999588 6:128198473-128198495 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
1015230641 6:130911369-130911391 GGGTGTGGGGGGCTAGGGGAGGG + Intronic
1015387503 6:132641149-132641171 GTGGGTAGGGGGCAAGAAGAGGG + Intergenic
1015571863 6:134630161-134630183 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1016147996 6:140700676-140700698 AAGGGTGGGGGGCAAGGGGAAGG - Intergenic
1016398901 6:143657083-143657105 GGGGGTCGGGGGCAAGGGGAGGG + Intronic
1016547446 6:145240372-145240394 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1016617048 6:146062343-146062365 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
1016857575 6:148686538-148686560 CTGAGTAGGGGGGAAGGTGTAGG - Intergenic
1017047415 6:150360229-150360251 GTGGGTGGGGGACAAGGGGAGGG - Intergenic
1017104989 6:150878994-150879016 CTAAGTAGGGGACAACGGGATGG - Intronic
1017236050 6:152118613-152118635 AGGGGTGGGGGGCAAGGGGAGGG + Intronic
1017271681 6:152514478-152514500 CGGGGTAGGGGACTAGGGGAGGG + Intronic
1017573389 6:155773333-155773355 AGGAGTAGGGGGCGAGGGGAAGG - Intergenic
1017592300 6:155990716-155990738 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1017619416 6:156280464-156280486 CAGTGTGGAGGGTAAGGGGAGGG + Intergenic
1018059265 6:160078005-160078027 ATGTGTAGGGGGCAAGGGCAGGG + Intronic
1018083615 6:160279696-160279718 AAGGGTAGGGGGCAAGAGGAAGG - Intergenic
1018381428 6:163261403-163261425 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1018458094 6:163971044-163971066 GCGTGTAGGGGCCAGGGGGAGGG - Intergenic
1018582436 6:165318695-165318717 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1018749231 6:166788685-166788707 CGGGGTGAGGGGCAAGGGGAGGG + Intronic
1019203057 6:170335198-170335220 GGGGGTTGGGGGCAAGGGGAGGG - Intronic
1019365832 7:632388-632410 CTGTGTTGGGGGGCAGTGGATGG - Intronic
1019554036 7:1619788-1619810 CTGTGCTGGGGGCAGGGAGATGG + Intergenic
1019640899 7:2103156-2103178 CTTTGTAGGGTGCAGGGGCAGGG - Intronic
1019801409 7:3090958-3090980 ATGTGGAGGGGGCAAGGGCCAGG + Intergenic
1020758755 7:12241392-12241414 TGGGGTAGGGGGCTAGGGGAGGG - Exonic
1020913417 7:14161666-14161688 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1020991215 7:15198653-15198675 GTGGGTAGGGGGCCAGGGAATGG + Intergenic
1021306007 7:19033345-19033367 AGGGGTCGGGGGCAAGGGGAGGG + Intronic
1021378429 7:19937343-19937365 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1022441547 7:30437223-30437245 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1022702416 7:32774091-32774113 GTGGGTAGAGGGCTAGGGGAGGG + Intergenic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1022928275 7:35079525-35079547 GTTGGTGGGGGGCAAGGGGAGGG - Intergenic
1023099656 7:36703535-36703557 GTGGGTGGGAGGCAAGGGGAGGG - Intronic
1023550594 7:41366227-41366249 CGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1023606058 7:41932117-41932139 CTGTGTGGGGGACAGAGGGAGGG + Intergenic
1024247299 7:47479983-47480005 ATGGGCAGGGGGCAAGGGCAAGG + Intronic
1024368281 7:48549205-48549227 GCGGGTAGAGGGCAAGGGGAGGG - Intronic
1024570559 7:50719523-50719545 GGGGGTAGGGGGCGAGGGGAGGG + Intronic
1024698397 7:51880595-51880617 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1024714311 7:52057738-52057760 GGGAGTCGGGGGCAAGGGGAGGG - Intergenic
1024957960 7:54945483-54945505 CGGGGTGGGGGGCTAGGGGAGGG + Intergenic
1025160151 7:56651823-56651845 CGGGATTGGGGGCAAGGGGAGGG - Intergenic
1025218803 7:57086355-57086377 GTGTGTGGGGGGGCAGGGGATGG - Intergenic
1025652546 7:63484084-63484106 GTGTGTGGGGGGGCAGGGGATGG + Intergenic
1026107364 7:67431806-67431828 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1026149770 7:67778042-67778064 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1026252567 7:68683779-68683801 CTATGGAGTGGGCAAGGGAATGG - Intergenic
1026292709 7:69022717-69022739 GGGAGTAAGGGGCAAGGGGAGGG - Intergenic
1026308833 7:69166264-69166286 ATGGGGAGGGGGGAAGGGGAGGG + Intergenic
1026359953 7:69594498-69594520 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1027583422 7:80026056-80026078 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1027708596 7:81567581-81567603 CTGCATAGGGGTCAAGGGAATGG + Intergenic
1027744598 7:82057441-82057463 ATGTGTTGGGGGAAAGGGGCAGG + Intronic
1027864029 7:83623866-83623888 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1027874520 7:83751342-83751364 GTGTGTGGGAGGTAAGGGGAGGG + Intergenic
1027919817 7:84378558-84378580 GGGTGTTGGGGGCAAGGGGACGG + Intronic
1028080841 7:86573172-86573194 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1028242167 7:88434632-88434654 TTGGGTAGGGGGCTAGGGGACGG + Intergenic
1028271087 7:88790419-88790441 CTGTCAGGGGTGCAAGGGGAGGG - Intronic
1028288435 7:89034391-89034413 GGGGGTAGGGGGCTAGGGGAGGG - Intronic
1028374016 7:90126061-90126083 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1028563455 7:92201676-92201698 GGGGGTAGGGGGCTAGGGGAGGG - Intronic
1028689431 7:93635189-93635211 GTGGGTGGAGGGCAAGGGGAGGG - Intronic
1028815110 7:95134318-95134340 GTGGGTGGGGGTCAAGGGGAGGG + Intronic
1028822930 7:95233369-95233391 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1028887078 7:95946146-95946168 CTGTCAGGGGGGCAGGGGGAGGG + Intronic
1029373127 7:100161965-100161987 CGGGGTGGGGAGCAAGGGGAGGG + Intronic
1029386746 7:100248460-100248482 CTGGGTGGGGGTCAGGGGGATGG - Intronic
1029438396 7:100574770-100574792 CTGTTGGGGGGGGAAGGGGAGGG + Exonic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029913217 7:104177715-104177737 CGGGGTGGAGGGCAAGGGGAGGG - Intronic
1029990653 7:104959876-104959898 GGGGGTAGGGGGCAGGGGGAGGG + Intergenic
1030377246 7:108767903-108767925 GTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1030403925 7:109086645-109086667 CGGGCTGGGGGGCAAGGGGAGGG + Intergenic
1030471865 7:109974711-109974733 CAGGGTGGGGGGCAAGGGGAGGG - Intergenic
1030679408 7:112418976-112418998 CGGGGTGGAGGGCAAGGGGAAGG + Intergenic
1030919289 7:115361251-115361273 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1030973499 7:116090965-116090987 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1031006981 7:116484421-116484443 GGGAGTTGGGGGCAAGGGGAGGG - Intronic
1031039240 7:116821638-116821660 AGGGGTGGGGGGCAAGGGGAGGG - Intronic
1031053124 7:116965406-116965428 AAGGGTGGGGGGCAAGGGGAGGG + Intronic
1031587690 7:123552486-123552508 GTGGGTGGGGGGCCAGGGGAGGG + Intronic
1031784245 7:126008897-126008919 GTGTGTTGGGGGCAAGAGGAGGG - Intergenic
1031856422 7:126928225-126928247 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1032083993 7:128874217-128874239 CTGTGGTGAGGGCAAGCGGAAGG - Intronic
1032263135 7:130352277-130352299 CTGTGCATCGGGCAAGGGGCTGG + Intronic
1032482435 7:132257602-132257624 CTGTCTTGGGGCCAAGGGTATGG + Intronic
1032591931 7:133199859-133199881 GTGAGTGGGGGTCAAGGGGATGG - Intergenic
1032832267 7:135640058-135640080 GGGGATAGGGGGCAAGGGGAGGG + Intronic
1032890127 7:136185573-136185595 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1033041869 7:137926578-137926600 GTGGGTAGCGGGCAAGGGGAGGG + Intronic
1033503207 7:141974592-141974614 GGGGGTAGGGGGCAAGGGGAAGG - Intronic
1033614033 7:142993975-142993997 GAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1033655385 7:143370131-143370153 CTGTGTTGGGGGCAGGGCCAAGG + Intergenic
1033764523 7:144473665-144473687 CTGTGTAGTGGAGAAAGGGATGG - Intronic
1033998499 7:147383618-147383640 CGGGGTGGGGAGCAAGGGGAGGG + Intronic
1034030460 7:147757128-147757150 GTTTGCAGGGGGCAAGAGGAAGG - Intronic
1034191253 7:149215096-149215118 CCATGTTGAGGGCAAGGGGATGG - Intronic
1034202386 7:149290519-149290541 CTGTGTAAGGTGCTAGAGGAGGG - Intronic
1034204294 7:149302364-149302386 CAGTGCAGGGAGCCAGGGGAAGG - Intergenic
1034378927 7:150672187-150672209 CGGGGTGGGGGGCTAGGGGAGGG - Intergenic
1034400448 7:150858273-150858295 CTGTGCATGGGGCAAGGGAGGGG + Intronic
1035919133 8:3657695-3657717 GTGGGTAGGGGGCTAGGGGAGGG + Intronic
1035921102 8:3677003-3677025 CGGGGTTGGGGGCAAGGGGAGGG + Intronic
1036131522 8:6118581-6118603 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1036287518 8:7456945-7456967 CTGGGTTGTGGACAAGGGGAGGG - Intronic
1036333962 8:7854580-7854602 CTGGGTTGTGGACAAGGGGAGGG + Intronic
1036626463 8:10476354-10476376 CGGGGTGGGGGCCAAGGGGAAGG + Intergenic
1036686970 8:10918220-10918242 CTGGCCAGGAGGCAAGGGGATGG - Intronic
1036925737 8:12903713-12903735 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1037161414 8:15777998-15778020 ATTGGTAGGGGGCAAGGAGAGGG - Intergenic
1037162077 8:15785647-15785669 GTGTGTAGGAGGCAGGGGCATGG - Intergenic
1037383971 8:18317876-18317898 CTGTGTGGGTGGCAAAGGAAGGG - Intergenic
1037542885 8:19889274-19889296 ATGTGTAAGGGGAAAGGAGAAGG + Intergenic
1037546133 8:19924742-19924764 GAGGGTGGGGGGCAAGGGGAGGG - Intronic
1037612383 8:20487052-20487074 GTGGGGGGGGGGCAAGGGGAGGG + Intergenic
1037644758 8:20783251-20783273 CTGTGCAGATGGCGAGGGGATGG + Intergenic
1037900079 8:22682977-22682999 CTGTGTTTGGAGGAAGGGGACGG + Intergenic
1038257894 8:25967662-25967684 GTGTGTTGGGGGCAAGGGTGAGG + Intronic
1038446932 8:27611007-27611029 CTGTGGAGGTGGCATGGGGAGGG - Intronic
1038762706 8:30399500-30399522 CTGTGTTGAGGGTAAGGGGCTGG + Intronic
1038846809 8:31237719-31237741 AGGGGTAGAGGGCAAGGGGAGGG - Intergenic
1039273953 8:35914285-35914307 GTGGGTAGGGGGTAAGGGGAGGG + Intergenic
1039391493 8:37184445-37184467 GTGGGTAGGGTGCAAGGGGAGGG + Intergenic
1039754238 8:40506239-40506261 GGGGGTAGGGGGCAAGGAGAGGG - Intergenic
1039777712 8:40753035-40753057 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1040014249 8:42688364-42688386 CGGGGTGGGGGGCAGGGGGAGGG + Intergenic
1040516123 8:48136532-48136554 ATGTCTGAGGGGCAAGGGGAGGG - Intergenic
1040536239 8:48313475-48313497 CAGTGGAGGTGGCAAGAGGAGGG - Intergenic
1040552338 8:48447445-48447467 CTTTTTTGGGGGGAAGGGGAGGG - Intergenic
1040553288 8:48455933-48455955 ATGGGTGGGGGGCAAGGGGAGGG + Intergenic
1040657283 8:49525965-49525987 TGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1040968274 8:53106621-53106643 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1041154094 8:54965929-54965951 GTGTGGAGGGGGCAAGAGAAGGG + Intergenic
1041500170 8:58531684-58531706 GTGGGTGAGGGGCAAGGGGAGGG + Intergenic
1041666826 8:60453698-60453720 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1041837892 8:62237665-62237687 GGGTGTGGGGGGCTAGGGGATGG - Intergenic
1041952099 8:63515177-63515199 ATGAGCAGGGGGCAAGGGAATGG + Intergenic
1042065774 8:64874158-64874180 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1042090053 8:65149218-65149240 CGGGGTGGGGGGCTAGGGGAAGG - Intergenic
1042130158 8:65579907-65579929 GGGGGTAGGGGGAAAGGGGAGGG + Intergenic
1042326557 8:67534858-67534880 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1042462902 8:69091599-69091621 ATGGGTTGGGGGCTAGGGGAGGG - Intergenic
1042616648 8:70656879-70656901 TAGTGTGGTGGGCAAGGGGAGGG + Intronic
1042785134 8:72537531-72537553 CTGTGGCGGCGGCAGGGGGATGG + Exonic
1042799227 8:72700195-72700217 GGGTTTGGGGGGCAAGGGGAGGG + Intronic
1042812334 8:72840051-72840073 CAGGGTGGGGGGCTAGGGGAGGG - Intronic
1042993068 8:74662435-74662457 AGGGGTGGGGGGCAAGGGGAGGG + Intronic
1043179968 8:77076392-77076414 GAGGGTCGGGGGCAAGGGGAGGG + Intergenic
1043318582 8:78952117-78952139 CAGGGTAGGGGGCTAGGGGAGGG + Intergenic
1043321965 8:78998775-78998797 GGGGGTAGGGGGCAAAGGGAGGG - Intergenic
1043352024 8:79372979-79373001 CGGGGTGGGGGGCAGGGGGAGGG + Intergenic
1043368591 8:79564214-79564236 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1043532969 8:81171185-81171207 GGGAGTGGGGGGCAAGGGGAGGG + Intergenic
1043646670 8:82530208-82530230 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1043791589 8:84475051-84475073 CTGGGTGGGGGGCTGGGGGAGGG - Intronic
1043870723 8:85428857-85428879 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1044313225 8:90719346-90719368 GGGTGTGGGGGGAAAGGGGAGGG + Intronic
1045052145 8:98336989-98337011 ATGTGTGTGGGGGAAGGGGAGGG + Intergenic
1045193173 8:99903448-99903470 CAGGGTGGGGGGCTAGGGGAGGG + Intergenic
1045536996 8:103039718-103039740 CTGTGTGTGTGGGAAGGGGAAGG + Intronic
1045570647 8:103365935-103365957 CAGGGTTGGGGGCTAGGGGAGGG - Intergenic
1045590271 8:103585728-103585750 GGGGGTTGGGGGCAAGGGGAGGG + Intronic
1045639947 8:104238298-104238320 AGGGGTAGGGGGCAAGGGGAGGG + Intronic
1045724889 8:105160765-105160787 CAGTGGCGGGGGCAAGGGGAAGG - Intronic
1045742734 8:105381067-105381089 AGGGGTGGGGGGCAAGGGGAGGG - Intronic
1045810006 8:106210227-106210249 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
1045868168 8:106893123-106893145 GAGGGTGGGGGGCAAGGGGAGGG - Intergenic
1045871091 8:106927860-106927882 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1046036455 8:108847875-108847897 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1046054831 8:109067052-109067074 TGGGGTAGGGGGAAAGGGGAGGG - Intergenic
1046254064 8:111673410-111673432 GGGTGTTGGGGGCAAGGGGAGGG - Intergenic
1046291230 8:112164582-112164604 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
1046542139 8:115599481-115599503 GAGAGTCGGGGGCAAGGGGAGGG - Intronic
1046688680 8:117257190-117257212 CGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1046862724 8:119112190-119112212 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1047054655 8:121150700-121150722 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1047086871 8:121527371-121527393 GTGAGTGGGGGGCTAGGGGAGGG - Intergenic
1047163347 8:122407080-122407102 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1047231069 8:122998547-122998569 GGGTGTGGGAGGCAAGGGGAGGG - Intergenic
1047374689 8:124284873-124284895 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1047457142 8:125025340-125025362 GTGGGTGGAGGGCAAGGGGAGGG + Intronic
1047516168 8:125556587-125556609 CTCCTTAGGGGGGAAGGGGAGGG + Intergenic
1047662082 8:127048084-127048106 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1047692769 8:127373220-127373242 TTGGGTGGGGGGCAAGGGGAGGG - Intergenic
1047771744 8:128035432-128035454 CTTTGTGGGGGGCCAAGGGATGG + Intergenic
1048149258 8:131877838-131877860 TGGTGTGGGGGGCAGGGGGAGGG - Intergenic
1048288774 8:133163822-133163844 CTGTGAAGGGGGCTAGAAGAGGG + Intergenic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048765274 8:137836820-137836842 CTGTGTTGGGGGAAGGGAGAGGG - Intergenic
1048812734 8:138303435-138303457 GGGGGCAGGGGGCAAGGGGAGGG + Intronic
1048862596 8:138735016-138735038 GTGGGTTGGGGGAAAGGGGAGGG + Intronic
1048929239 8:139297925-139297947 CTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1049244003 8:141551825-141551847 CAGGGTAGGGCGGAAGGGGATGG - Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049532641 8:143162137-143162159 CTGTGTGGGTGCCAAGTGGAGGG - Intergenic
1049569630 8:143363070-143363092 CTGTTTGTGGGGCCAGGGGAGGG - Intergenic
1049688381 8:143948317-143948339 CTGTGCAGTGGGGAAGGGCAGGG + Intronic
1050032306 9:1399341-1399363 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
1050356246 9:4785495-4785517 CGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1050403546 9:5282628-5282650 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1050517393 9:6459067-6459089 GAGGGTAGGGGGCTAGGGGAAGG + Intronic
1050699110 9:8317402-8317424 CATTTTAGGGGGAAAGGGGAGGG - Exonic
1050757322 9:9021973-9021995 CGGGGTGGGGGGCAAGGGGAGGG + Intronic
1050781553 9:9342851-9342873 CGGGGTAGGGGGCTAGGGGAGGG - Intronic
1050812729 9:9769750-9769772 GTGGGTGGGGGGCTAGGGGAGGG - Intronic
1050863795 9:10471144-10471166 GTGGGTTGGGGGCTAGGGGAAGG + Intronic
1050886141 9:10768755-10768777 CAGAGTAGGGGGCAGGGAGATGG - Intergenic
1051072915 9:13194545-13194567 GGGTGGTGGGGGCAAGGGGAGGG + Intronic
1051184912 9:14450110-14450132 GAGTGTAGGGGGCTGGGGGAGGG - Intergenic
1051354482 9:16229310-16229332 GGGGGTAGGGGGCTAGGGGAGGG + Intronic
1051439736 9:17071981-17072003 AGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1051451089 9:17198670-17198692 GGGAGTGGGGGGCAAGGGGAGGG - Intronic
1051477953 9:17529579-17529601 CGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1051614363 9:18993261-18993283 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1051615766 9:19004717-19004739 TGGAGTAGGGGGCAAGGGGAGGG + Intronic
1051629556 9:19128899-19128921 CTGTGTCGGGGGCCGGGGGGGGG - Intronic
1052003472 9:23317490-23317512 GTGGGTAGGGGACTAGGGGAGGG - Intergenic
1052102279 9:24463222-24463244 ATCTGTGGGGGGAAAGGGGAAGG - Intergenic
1052143494 9:25019729-25019751 GGGAGTGGGGGGCAAGGGGAGGG - Intergenic
1052203408 9:25809587-25809609 AGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1052330687 9:27264863-27264885 CGGGGTGGGAGGCAAGGGGAGGG - Intergenic
1052380722 9:27767860-27767882 CGGGGTTGGGGGAAAGGGGAGGG + Intergenic
1052556147 9:30020721-30020743 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1052709684 9:32038265-32038287 GCAGGTAGGGGGCAAGGGGAGGG + Intergenic
1052893745 9:33728055-33728077 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1053033322 9:34801908-34801930 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1054194603 9:62017562-62017584 CGGGGTGGGGGGCTAGGGGAAGG - Intergenic
1054643805 9:67571128-67571150 CGGGGTGGGGGGCTAGGGGAAGG + Intergenic
1054971593 9:71094091-71094113 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1054991939 9:71337932-71337954 CAGGGTGGGGGGCCAGGGGAGGG + Intronic
1054992520 9:71345589-71345611 GGGGGTGGGGGGCAAGGGGAAGG + Intronic
1055032552 9:71785080-71785102 AGGGGTGGGGGGCAAGGGGAGGG + Intronic
1055074173 9:72196733-72196755 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1055208983 9:73766210-73766232 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1055438731 9:76318316-76318338 GAGGGTAGGGGGCAAGGGGAGGG + Intronic
1055646521 9:78366821-78366843 CTCTGCAGAGGGCAGGGGGAGGG + Intergenic
1055743906 9:79421921-79421943 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1055867878 9:80838021-80838043 CGGGGTTGGGGGCTAGGGGAGGG - Intergenic
1056057568 9:82843230-82843252 CTGTCGAGGGGTCAGGGGGAGGG + Intergenic
1056261987 9:84858150-84858172 CTGGGTATTGGGGAAGGGGAAGG - Intronic
1057450912 9:95159173-95159195 TGGAGTGGGGGGCAAGGGGAGGG - Intronic
1057615417 9:96585351-96585373 GGGGGTTGGGGGCAAGGGGAGGG - Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058034013 9:100231498-100231520 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1058391552 9:104501180-104501202 AGGGGTCGGGGGCAAGGGGAGGG - Intergenic
1058694420 9:107547337-107547359 CAGAGGAGGGGGCAAGGGCAGGG + Intergenic
1059041549 9:110820659-110820681 CTTTGCTGGGGGCAAGTGGAGGG + Intergenic
1059433523 9:114263645-114263667 CTGTGCAGGGGGGATGGGGGTGG + Intronic
1059511207 9:114849291-114849313 GAGGGTAGGGGGCAAGGGGAGGG + Intergenic
1059601706 9:115785627-115785649 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1059692990 9:116703759-116703781 CTCTGTAGGAGGGAAGTGGAAGG + Intronic
1059801953 9:117759042-117759064 GTGGGTGGGGGGCAGGGGGAGGG - Intergenic
1059875006 9:118625080-118625102 GGGGTTAGGGGGCAAGGGGAAGG - Intergenic
1059995002 9:119900269-119900291 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1059996932 9:119920000-119920022 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1060269069 9:122128438-122128460 CTGTGGAGGGGGCAGGGGTTGGG - Intergenic
1060272820 9:122159387-122159409 CTGTGGAGGGCGAAAGGGGGAGG + Intronic
1060384170 9:123207584-123207606 CGGGGTCGGGGGCTAGGGGAGGG + Intronic
1060801154 9:126546549-126546571 CTGTGAAGGGGACATAGGGATGG + Intergenic
1060975110 9:127760444-127760466 TGGTGTAGGGGGCTAGGGGAGGG + Intronic
1061275525 9:129567892-129567914 CTTTGTAGGAGGCCTGGGGAGGG + Intergenic
1062016492 9:134293727-134293749 CTGTGGAGGGGGCAGGGCGTGGG - Intergenic
1062194086 9:135263779-135263801 TGGGGTAGGGGGCAGGGGGAGGG - Intergenic
1062210365 9:135360311-135360333 CTGTGGAGGGGGCCTGGGAAAGG - Intergenic
1062359753 9:136182136-136182158 CTGTGCAGGGCGCAGGGAGAAGG - Intergenic
1062544187 9:137054292-137054314 CTGAGTGGGCGGGAAGGGGAAGG - Intergenic
1203532215 Un_GL000213v1:156795-156817 CAGGGTGGGGGGCTAGGGGAAGG - Intergenic
1185669659 X:1797551-1797573 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1185749605 X:2600193-2600215 CAGGGTGGGGGGCAAGGGGAGGG + Intergenic
1185911859 X:3988879-3988901 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1186135955 X:6521107-6521129 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1186266087 X:7835310-7835332 CTTTGTAGGGGGTAGGGAGATGG - Intergenic
1186333191 X:8558171-8558193 GGGGGTGGGGGGCAAGGGGAGGG + Intronic
1186506589 X:10098306-10098328 CTGGGGAGGGGGGAGGGGGAAGG - Intronic
1186840564 X:13480771-13480793 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1186981911 X:14966128-14966150 CGGGGTGGGGGGCGAGGGGAGGG - Intergenic
1187018913 X:15359535-15359557 GTGGGTGGGGGGCAAAGGGAGGG - Intronic
1187548664 X:20279367-20279389 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1187575936 X:20555242-20555264 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1187583657 X:20636432-20636454 CTGTGCAGGGGCCAAGTGGCAGG - Intergenic
1187597980 X:20796154-20796176 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1187686437 X:21820172-21820194 CGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1187699400 X:21950587-21950609 GGGGGTGGGGGGCAAGGGGAGGG - Intronic
1187702756 X:21979345-21979367 GGGGGTAGGGGGCTAGGGGAAGG - Intronic
1187760781 X:22581545-22581567 GTGGGTTGGGGGCAAGGGCAGGG + Intergenic
1187785517 X:22881119-22881141 GGGGGTAAGGGGCAAGGGGAGGG + Intergenic
1187943404 X:24403119-24403141 ATGGGGAGGGGGCAGGGGGAGGG - Intergenic
1188191853 X:27181258-27181280 CTGTGTAGGGGCCAAAGGCTTGG - Intergenic
1188254796 X:27948738-27948760 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1188267093 X:28090757-28090779 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1188413575 X:29904515-29904537 CGGGGTTGGGGGCAAAGGGAGGG - Intronic
1188610966 X:32097241-32097263 CGAGGTGGGGGGCAAGGGGAGGG - Intronic
1188628306 X:32315365-32315387 GCGGGTGGGGGGCAAGGGGAGGG + Intronic
1188671598 X:32888295-32888317 GGGCGTAGGGAGCAAGGGGAGGG - Intronic
1189009096 X:37028371-37028393 GGGGGTGGGGGGCAAGGGGATGG - Intergenic
1189015288 X:37090739-37090761 CTGTGTTGAGGGTAAGGGGCTGG + Intergenic
1189425083 X:40892539-40892561 CTGTCATGGGGGCGAGGGGAGGG + Intergenic
1189673554 X:43437903-43437925 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1189859167 X:45254475-45254497 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1190001250 X:46689761-46689783 GGGGGTAGGGGGAAAGGGGAGGG - Intronic
1190026724 X:46930738-46930760 CTGTGATGGGGGCAAATGGATGG - Intronic
1190122455 X:47673198-47673220 GGGGGTAGGGGACAAGGGGAGGG - Intergenic
1190358632 X:49628440-49628462 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1190358967 X:49631501-49631523 GAGGGTGGGGGGCAAGGGGAGGG - Intergenic
1190510728 X:51171286-51171308 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1190511074 X:51174986-51175008 AGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1190542708 X:51495621-51495643 GTGTGTGGGGGGCGAGGGGTGGG - Intronic
1190581007 X:51893336-51893358 CGGTGTGTGGGGCAAGGGGTGGG + Intronic
1190617119 X:52245177-52245199 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1190869925 X:54415965-54415987 CTCTGGAGGGGCCAAGGGGGAGG + Intergenic
1190895428 X:54613804-54613826 CTGTGGAGGTGGCAGGGGCAGGG + Intergenic
1190942265 X:55053364-55053386 CTGTCAAGGGGGCGAGGGGAGGG + Intergenic
1190970418 X:55342652-55342674 CGGTGTAGGGGGAGAGGGGGAGG - Intergenic
1191113469 X:56827513-56827535 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1191115973 X:56853112-56853134 GGGGGTAGGGGGCAAGGGGAGGG + Intergenic
1191143671 X:57141941-57141963 GGGTGTGGGGGGCAAGGGGAGGG - Intergenic
1191150446 X:57215814-57215836 AGGTGGTGGGGGCAAGGGGAAGG + Intergenic
1191208625 X:57860987-57861009 GTGAGTTGGGGGCTAGGGGAAGG + Intergenic
1191591832 X:62894078-62894100 CTGGGTGGGGGGCAATGGGAGGG + Intergenic
1191721591 X:64233674-64233696 GGAGGTAGGGGGCAAGGGGAGGG + Intergenic
1191810316 X:65179257-65179279 GGGTGTTGGGGGTAAGGGGAGGG + Intergenic
1191821312 X:65311994-65312016 GGGAGTAGGGGGCAGGGGGAGGG + Intergenic
1191854555 X:65613022-65613044 GGGGGTTGGGGGCAAGGGGAGGG - Intronic
1191901129 X:66041517-66041539 CTTTTTAGCGGGGAAGGGGAGGG - Intergenic
1191963030 X:66724579-66724601 AGTTGTGGGGGGCAAGGGGAGGG + Intergenic
1191985767 X:66978883-66978905 CTGGGTGGGGGACTAGGGGAGGG + Intergenic
1192302758 X:69923280-69923302 GGGGGTGGGGGGCAAGGGGACGG - Intronic
1192333629 X:70199922-70199944 CTGAGTAGGGAGCAAGGGTCTGG - Intronic
1192437571 X:71152406-71152428 CTGGGGTGGGGGAAAGGGGAAGG - Intronic
1192637554 X:72833636-72833658 GGGGGTGGGGGGCAAGGGGAAGG + Intronic
1192644160 X:72887178-72887200 GGGGGTGGGGGGCAAGGGGAAGG - Intronic
1192821457 X:74649969-74649991 CTGGGTGGGGGGCGAGGAGAGGG - Intergenic
1192906078 X:75551975-75551997 GGGAGTAGGGGGCTAGGGGAGGG + Intergenic
1192911800 X:75612555-75612577 ATGGTTAGGGGGCTAGGGGAGGG - Intergenic
1193110785 X:77727679-77727701 GGGGGTTGGGGGCAAGGGGAGGG + Intronic
1193437615 X:81496486-81496508 CTTTGTTGGGGGCAGGGGGAGGG + Intergenic
1193623719 X:83790064-83790086 GGGTGTGGGGCGCAAGGGGAGGG + Intergenic
1193902081 X:87192856-87192878 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1193907305 X:87259614-87259636 GATTGTAGGGGGCTAGGGGAGGG + Intergenic
1193918150 X:87392642-87392664 CTGTGGAGGGGGGAAGAGTAAGG + Intergenic
1194010637 X:88556817-88556839 CGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1194030361 X:88805656-88805678 AGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1194031390 X:88820226-88820248 GTGGGTGGGGGGCAAGGGGAGGG + Intergenic
1194159119 X:90428728-90428750 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1194196971 X:90905929-90905951 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1194354184 X:92860296-92860318 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1194376183 X:93136515-93136537 GGGGGTTGGGGGCAAGGGGAGGG + Intergenic
1194626994 X:96237223-96237245 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1194663317 X:96650061-96650083 CAGAGAAGGGGGCAAGGGGTGGG - Intergenic
1194754585 X:97723388-97723410 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1194786681 X:98093408-98093430 GGGGGTAGGGGGCTAGGGGAGGG + Intergenic
1194953738 X:100155691-100155713 GGGGGTGGGGGGCAAGGGGAAGG - Intergenic
1195063713 X:101220234-101220256 CTGTGTGGCGGGCGAGGGGTGGG + Intronic
1195199640 X:102535322-102535344 GGGGGTCGGGGGCAAGGGGAGGG + Intergenic
1195481586 X:105351630-105351652 GTGGGTGGGGGGCTAGGGGAGGG + Intronic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1195549748 X:106154016-106154038 GGGTGTAGGGGGCAAGGGGAGGG + Intergenic
1195650682 X:107280556-107280578 GGGGGTCGGGGGCAAGGGGAGGG - Intergenic
1195651730 X:107291789-107291811 CGGGGTCGGGGGCTAGGGGAGGG + Intergenic
1195775089 X:108394275-108394297 GGGTGTAGGGGTCTAGGGGAGGG + Intronic
1196037982 X:111167724-111167746 GGGAGTAGGGGGCTAGGGGAGGG + Intronic
1196092159 X:111756261-111756283 CGGGGTTGGGGGCAAAGGGAGGG + Intronic
1196095321 X:111792305-111792327 TGGGGTCGGGGGCAAGGGGAGGG + Intronic
1196387858 X:115177784-115177806 GGGTGTGGGGGGCAAGGGGAGGG - Intronic
1196517850 X:116634057-116634079 CGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1197029544 X:121797289-121797311 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1197051756 X:122067375-122067397 CAGGGTCGGGGTCAAGGGGAGGG + Intergenic
1197063228 X:122207706-122207728 GGGGGTAGGGGGCTAGGGGAGGG - Intergenic
1197191651 X:123654255-123654277 CAGGGTAGGGGGTTAGGGGAGGG + Intronic
1197434847 X:126414097-126414119 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1197479114 X:126960766-126960788 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1197538893 X:127729547-127729569 GCGGGTAGGGGGCAAGGAGAGGG - Intergenic
1197621742 X:128758278-128758300 GTGGGTTGGGGGCAAGGGGAGGG + Intergenic
1197636965 X:128926204-128926226 GAGTGTGGGGGGCTAGGGGAGGG - Intergenic
1197928475 X:131671474-131671496 CGGGGTGGGGGGCAAGAGGAGGG + Intergenic
1197990334 X:132310749-132310771 GTATGTAGGGGGTGAGGGGAAGG - Intergenic
1198010017 X:132542939-132542961 GGGAGTAGGGGGTAAGGGGAGGG - Intergenic
1198699301 X:139380806-139380828 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1198709025 X:139481362-139481384 CGGGGTTGGGGGAAAGGGGAGGG - Intergenic
1198754094 X:139964913-139964935 GGGGGTTGGGGGCAAGGGGAGGG + Intronic
1198764566 X:140067654-140067676 GGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1198794540 X:140381442-140381464 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1198816594 X:140598100-140598122 GGGCGTTGGGGGCAAGGGGAGGG + Intergenic
1198833571 X:140777140-140777162 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1198835676 X:140802564-140802586 GGGTGTGGGGGGCTAGGGGAGGG - Intergenic
1198884676 X:141321418-141321440 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1198886464 X:141343874-141343896 CGGGCTTGGGGGCAAGGGGAGGG - Intergenic
1198943660 X:141985963-141985985 GGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1198978188 X:142361364-142361386 GTGGGTGGGGGGCTAGGGGAGGG - Intergenic
1198984551 X:142434323-142434345 GAGGGTAGGGGGCAAGGGGAGGG + Intergenic
1198986785 X:142463890-142463912 GGGGGTTGGGGGCAAGGGGAGGG - Intergenic
1199021604 X:142884718-142884740 GGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1199029153 X:142975768-142975790 CAGAGTGGGGGGCTAGGGGAGGG + Intergenic
1199099760 X:143785197-143785219 GTGGGTGGAGGGCAAGGGGAGGG + Intergenic
1199403202 X:147424761-147424783 GTGGGTGGAGGGCAAGGGGAGGG + Intergenic
1199409119 X:147499297-147499319 TGGGGTAGGGGGCAAGGGGAGGG - Intergenic
1199524367 X:148776000-148776022 GGGTGTGGGGGGCAAGGGGAGGG - Intronic
1199848227 X:151706931-151706953 CTGGGGAGAGGGCAAGGAGAGGG - Intergenic
1200012920 X:153133670-153133692 CTGTGTCGGGGGCGGGGGGGAGG - Intergenic
1200026681 X:153266253-153266275 CTGTGTCGGGGGCGGGGGGGAGG + Intergenic
1200081810 X:153580696-153580718 CTGTGTGGTGGGCAGGGGGCTGG + Exonic
1200089740 X:153628831-153628853 CGGGGGAGGGGGCAAGGGAAGGG + Intergenic
1200162290 X:154015788-154015810 CTGGGCTGGGGGCAGGGGGAAGG - Intronic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1200542820 Y:4480135-4480157 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1200607743 Y:5287765-5287787 GTGGGTAGGGGGCTAGGGGAGGG + Intronic
1200662537 Y:5977317-5977339 GTGGGTGGGGGGCTAGGGGAGGG + Intergenic
1201320512 Y:12693587-12693609 GTGGGGAGGGGACAAGGGGATGG + Intergenic
1201854545 Y:18527071-18527093 GGGAGTAGGGGGCAAGTGGAAGG + Intergenic
1201878776 Y:18793314-18793336 GGGAGTAGGGGGCAAGTGGAAGG - Intronic
1201888646 Y:18916713-18916735 GGGTGTGGGGGGCTAGGGGAGGG + Intergenic
1201959496 Y:19663071-19663093 GGGTGTCGGGGGCTAGGGGAGGG + Intergenic
1201980495 Y:19903354-19903376 GTGTTTGGGGGACAAGGGGAGGG + Intergenic