ID: 1079790235

View in Genome Browser
Species Human (GRCh38)
Location 11:24728409-24728431
Sequence GGCCTAACTAGAGCAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079790235_1079790238 9 Left 1079790235 11:24728409-24728431 CCTGCTTCTGCTCTAGTTAGGCC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1079790238 11:24728441-24728463 TTTTGTCTGGACTATTGCAATGG 0: 1
1: 0
2: 8
3: 33
4: 252
1079790235_1079790236 -4 Left 1079790235 11:24728409-24728431 CCTGCTTCTGCTCTAGTTAGGCC 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1079790236 11:24728428-24728450 GGCCAGCGTAATCTTTTGTCTGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079790235 Original CRISPR GGCCTAACTAGAGCAGAAGC AGG (reversed) Intronic
901379849 1:8865814-8865836 GCCTTAAATAGAGCAGAAGCGGG + Intronic
901393929 1:8966794-8966816 GACCTCTCTAGAGCAGGAGCAGG + Intronic
903092192 1:20931122-20931144 GGGCTAACTAAGGCAGAAGAAGG + Intronic
907221753 1:52912074-52912096 TGTCTAACAACAGCAGAAGCAGG - Intronic
908979234 1:69934296-69934318 GGCCTAATGAGAACAGAAGTTGG + Intronic
910486754 1:87723420-87723442 GGCCTCAATAGAGCAAAAGGTGG + Intergenic
1064872540 10:19955009-19955031 GGCCCAACTAGAGCCCAATCTGG - Intronic
1065752568 10:28900688-28900710 GGCCTGAGTAGAACAGAAGGTGG + Intergenic
1069996538 10:72345231-72345253 GGCCTAATCAGGGCAGGAGCTGG - Intronic
1073137385 10:101227470-101227492 GGCCGAACTCGAGCAGAACTCGG - Exonic
1079790235 11:24728409-24728431 GGCCTAACTAGAGCAGAAGCAGG - Intronic
1080448235 11:32356951-32356973 GGCAGAAATGGAGCAGAAGCTGG - Intergenic
1084107850 11:66991908-66991930 GTCCTACCCAGAGCAGAAGTTGG - Intergenic
1087500017 11:98938988-98939010 GCCCTCACAAGACCAGAAGCTGG - Intergenic
1088700250 11:112405109-112405131 GGCCTAACTCGAGTAGATGGAGG + Intergenic
1088970884 11:114773757-114773779 GGCCTAAGTAGAACAAAAGGTGG + Intergenic
1090137014 11:124209622-124209644 GGCCAAACTGGAGCAGAGGATGG - Intergenic
1090736626 11:129616831-129616853 GGCATGACTAGAGTAGAAGGAGG + Intergenic
1090865601 11:130698038-130698060 GCCCGAAGCAGAGCAGAAGCAGG - Intronic
1098386080 12:69920176-69920198 GACCTAACCTGAGTAGAAGCTGG + Intronic
1100764165 12:97845392-97845414 AACCTAACTACAGGAGAAGCTGG + Intergenic
1105014935 12:132780824-132780846 GGCCTCACTAGAGAAGGAGAAGG - Exonic
1107705269 13:43096937-43096959 GGCCTCACTAGGGCCTAAGCTGG - Intronic
1108395071 13:49983951-49983973 GGCCCATCTAGAGCAGGAGCTGG + Intergenic
1108715715 13:53075883-53075905 GGCATAGCTAGAGCACAGGCAGG + Intergenic
1112132063 13:96535187-96535209 GGCCTAACTTTAGTAGAAGAAGG + Intronic
1118297651 14:64585213-64585235 GCCCCAACAAAAGCAGAAGCAGG + Intronic
1120562262 14:86009837-86009859 GGCCTGACTAGAGCAAAAGGTGG - Intergenic
1122762088 14:104036496-104036518 GGCTTGGCTAGTGCAGAAGCAGG + Intronic
1126692865 15:51301381-51301403 GTCCTAACTTGACCAGAGGCAGG + Intronic
1127846821 15:62877601-62877623 GGCCTAAGGTGATCAGAAGCAGG + Intergenic
1129716084 15:77851903-77851925 GGCACAATTAGAGCAGAGGCTGG + Intergenic
1131341711 15:91608660-91608682 GGCATCACTTGAGCAGACGCTGG + Intergenic
1133720374 16:8489011-8489033 GGCATTAATAGAACAGAAGCAGG + Intergenic
1135407049 16:22206269-22206291 GGTCTAGGTTGAGCAGAAGCGGG - Exonic
1138683241 16:58702159-58702181 GTCCTCACCAGAGCAGATGCTGG + Intergenic
1142252953 16:89001122-89001144 GGCCACACCAGGGCAGAAGCTGG - Intergenic
1142351719 16:89583723-89583745 TGCCAAACTTGAGCAGCAGCGGG - Exonic
1144476689 17:15595031-15595053 GGCCTTCTTAGAGCAAAAGCAGG - Intronic
1144713867 17:17420981-17421003 AGCCTAACTCGAGCAGAGGGAGG - Intergenic
1144833641 17:18145249-18145271 GGCCTAGATAGAGCAGGAGGTGG + Intronic
1144921562 17:18768372-18768394 GGCCTTCTTAGAGCAAAAGCAGG + Intronic
1158283792 18:55855951-55855973 GGTCTCCCTAGAGGAGAAGCTGG + Intergenic
1162565792 19:11445408-11445430 GGCCCAACAGGAGCAGGAGCTGG + Exonic
1164890406 19:31819069-31819091 TTCCTAACCCGAGCAGAAGCAGG + Intergenic
925734792 2:6953978-6954000 AGCCTAACTAGAGAAAAAGAAGG - Intronic
926684425 2:15687857-15687879 GGCCTGACTTTAGGAGAAGCAGG + Intergenic
926756254 2:16238520-16238542 GGCATGACCAGAGCAGAAGAAGG + Intergenic
927666089 2:25033858-25033880 AACCTAACTTGAGCAAAAGCAGG - Intergenic
928175905 2:29034178-29034200 GGCCTGACCAGAGCAGCACCTGG + Intronic
928460956 2:31472127-31472149 GGCCTGAGTAGAGCAAAAGGTGG - Intergenic
929420544 2:41785562-41785584 GGCCTGACTACTGCAGAAACTGG + Intergenic
932722595 2:74148492-74148514 GGCCTAACTAAACCAGTGGCGGG + Intergenic
933069067 2:77835350-77835372 GGCCTAAAAAGAGAAGAAACTGG - Intergenic
937616181 2:123924503-123924525 GGCCTCACAGGAGCAGATGCTGG - Intergenic
938840006 2:135151356-135151378 GGCCTAAACAGTACAGAAGCAGG - Intronic
940287434 2:152046664-152046686 GCCCTAAGCAGAGGAGAAGCAGG + Intronic
940896424 2:159085595-159085617 GGCCTCACCAAAGCAGATGCTGG - Intronic
942664441 2:178302109-178302131 GACCTAATTAAAGCAAAAGCTGG - Intronic
944415982 2:199480213-199480235 GGATTGACAAGAGCAGAAGCTGG + Intergenic
946371125 2:219281944-219281966 GGCCCATCTCGGGCAGAAGCTGG + Exonic
947355958 2:229295908-229295930 GGCCTTCCTGGAGCAGATGCTGG - Intergenic
1182835464 22:33337987-33338009 GGACTACCTAGAGCAGAGGCAGG - Intronic
1182896856 22:33866106-33866128 GGCCTACCCAGAGCTGAGGCCGG - Intronic
953422112 3:42762196-42762218 GGTCAAACAAAAGCAGAAGCTGG + Intronic
955636488 3:61035813-61035835 GGACTAACTAGAGTAAAAGCAGG - Intronic
956793449 3:72697996-72698018 GTCCTAAGGACAGCAGAAGCTGG - Intergenic
957480612 3:80788735-80788757 GGCCTAAATAGAACAAAAGGTGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
964674329 3:159260760-159260782 AGCCTCACTAAAGCAGAATCTGG - Intronic
967366774 3:188695783-188695805 GTGCTAATTAGACCAGAAGCTGG - Intronic
967919981 3:194607267-194607289 GGCCTCACCAGTGCAGATGCTGG + Intronic
967931343 3:194692749-194692771 GGCCTCACCAGAGCAGAAGCTGG - Intergenic
968293012 3:197553625-197553647 GGATGGACTAGAGCAGAAGCAGG + Intronic
975373144 4:73611171-73611193 GGCCAAGCTACAGCAGAGGCTGG - Intronic
978501353 4:109413291-109413313 GGCCTAAGAAGAGGAGAAGAGGG + Intergenic
978613179 4:110566784-110566806 GGCCAAAATAGAACAGAAGATGG - Intergenic
985623403 5:968644-968666 GGCTTCCCAAGAGCAGAAGCAGG + Intergenic
985809898 5:2075268-2075290 GGCCTCACAAGGGCAGAATCAGG - Intergenic
986866156 5:11990202-11990224 GGCCTGACTAGACCATAAGCTGG + Intergenic
987472546 5:18351042-18351064 CACTTACCTAGAGCAGAAGCTGG - Intergenic
988657624 5:33229479-33229501 TGCCAAAATAAAGCAGAAGCCGG + Intergenic
988786879 5:34573221-34573243 GGGTTAACTAGGGCAGAAGCGGG + Intergenic
993573392 5:89570450-89570472 AGCTTCACTAGAACAGAAGCAGG + Intergenic
994706745 5:103216202-103216224 GCCCAAACTGGAGCAGAAGGAGG - Intergenic
996308955 5:122080797-122080819 GGCCAAATTACAGGAGAAGCAGG + Intergenic
997303292 5:132822049-132822071 TGGCTGACTAGAGCAGAAGAGGG - Intergenic
999757777 5:154677945-154677967 TCCCTGACTAGAGCAGAAGGAGG - Intergenic
1000211780 5:159113959-159113981 AGCCTGACTTCAGCAGAAGCCGG - Intergenic
1005483919 6:26281155-26281177 GGCTTGACCAGAGCAGAAGTGGG + Intergenic
1006332752 6:33404108-33404130 GTCCCAACTAGAGGAGAAGGAGG + Exonic
1015687215 6:135877942-135877964 AGGGTTACTAGAGCAGAAGCAGG + Intronic
1016530983 6:145057931-145057953 GGAGTAAATAGAACAGAAGCTGG - Intergenic
1017657373 6:156642765-156642787 GGCCTGAATAGAGCAAAAGGCGG - Intergenic
1022336367 7:29425600-29425622 GACCTAACTGTAGCAGAAGTGGG + Intronic
1022667966 7:32428870-32428892 TGCCTACGTAGAGCAGAAGCAGG + Intergenic
1022739797 7:33109646-33109668 CGCCTAGCTGGAGCCGAAGCGGG + Intergenic
1027374821 7:77538267-77538289 GGCCTCAGGAGAGGAGAAGCGGG - Intronic
1028882531 7:95896057-95896079 GGACAAATTATAGCAGAAGCTGG + Intronic
1030771181 7:113476208-113476230 GGCCTAGGGTGAGCAGAAGCAGG - Intergenic
1031395587 7:121269899-121269921 AGCCTCACCAGAGCAGATGCTGG - Intronic
1032130662 7:129225022-129225044 GGCCGACCAAGAGCAGGAGCTGG + Exonic
1032748143 7:134808501-134808523 GGCCTGACTAGAACATGAGCTGG - Intronic
1032781727 7:135169638-135169660 GGCCAAACTAGATCAGAGGCTGG - Intronic
1034105300 7:148484568-148484590 GGCCTAACTAGAACAAAAAGCGG - Intergenic
1035521924 8:281759-281781 GGCCTGAATAGAGCAAAAGGTGG + Intergenic
1036565355 8:9933755-9933777 GGGCGAACTGGAGCAGAGGCGGG - Intergenic
1037422843 8:18722252-18722274 TCCCTAACTAGACAAGAAGCTGG + Intronic
1039213453 8:35241136-35241158 TGCCTCACAAGAGCAGCAGCAGG - Intronic
1039282516 8:36001607-36001629 GGCTTAATTAGAGCAAAAGAAGG + Intergenic
1042472448 8:69206786-69206808 GGCCTGAATAGAGCAAAAGGTGG + Intergenic
1043693202 8:83183537-83183559 GCCCTAACTAGAAGAGAAGAAGG - Intergenic
1044605976 8:94047783-94047805 GGCCTAAATAGAACAAAAGGTGG + Intergenic
1048094991 8:131282670-131282692 GGCCTAAATACAGCAGAATGGGG - Intergenic
1048302130 8:133259550-133259572 GGCCTCACAAGAGCAGTAGATGG + Intronic
1048590523 8:135816891-135816913 GGCCTAAATAGAACAAAAGGAGG + Intergenic
1053371813 9:37567879-37567901 GGACTAAATAGAGTAGAAGCGGG - Intronic
1057187385 9:93064506-93064528 GCCCTCACTATAGCAGAACCTGG + Intronic
1058043333 9:100329685-100329707 AGCCAAACTAGATCAGAAGAGGG + Intronic
1061775470 9:132960251-132960273 GACCCAGCTTGAGCAGAAGCAGG + Intronic
1062079687 9:134617301-134617323 GGACTAACAGGAGCACAAGCCGG - Intergenic
1062270476 9:135705931-135705953 GGCCTCACTGGAGCAGAGGTGGG + Intronic
1189301719 X:39957117-39957139 GGCCTGCCCAGAGCAGAATCAGG + Intergenic
1192947687 X:75983666-75983688 GCTCTAACTGGAGCAGAAGTGGG + Intergenic
1194155084 X:90378340-90378362 GGCCTAAATAGAACAAAAGGGGG - Intergenic
1200501436 Y:3955276-3955298 GGCCTAAATAGAACAAAAGGGGG - Intergenic