ID: 1079794625

View in Genome Browser
Species Human (GRCh38)
Location 11:24785066-24785088
Sequence TAGTGTAACTACAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079794625_1079794628 -2 Left 1079794625 11:24785066-24785088 CCTTCTTCCCTGTAGTTACACTA 0: 1
1: 0
2: 0
3: 16
4: 182
Right 1079794628 11:24785087-24785109 TATTTATGCTCATTCCTCTTTGG 0: 1
1: 0
2: 0
3: 26
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079794625 Original CRISPR TAGTGTAACTACAGGGAAGA AGG (reversed) Intronic
906376164 1:45298609-45298631 AACTGTGACTAAAGGGAAGAGGG - Intronic
907769475 1:57446198-57446220 TGGTGTATCTACAGTGAAGATGG - Intronic
912775703 1:112505132-112505154 TAGTGCCACTATGGGGAAGAGGG + Intronic
915536235 1:156537517-156537539 TGGAGTATCTACAGGGAAGCTGG + Intronic
916298250 1:163244332-163244354 TAGTGAAACTTCAGGAGAGATGG - Intronic
916446870 1:164880741-164880763 TAGTGTGTCTAGAGGGAAGTAGG + Intronic
916690138 1:167182248-167182270 GATAGTAACTGCAGGGAAGAGGG - Intergenic
918226017 1:182484148-182484170 TAGTTCAGCTACAGGGAAGCAGG + Intronic
919556815 1:199066304-199066326 TAGTGCAGCCTCAGGGAAGATGG + Intergenic
921715582 1:218414077-218414099 TAGTGAAAGTTCAGGGTAGATGG + Intronic
924431827 1:244004004-244004026 TAGTGGAGCTCCAGAGAAGATGG + Intergenic
1064361319 10:14667876-14667898 TAGAGTAACTACAGGGGCGTTGG + Intronic
1068159359 10:53243850-53243872 GAGTGTAACTACTGAGAATAAGG + Intergenic
1069089575 10:64183269-64183291 TTGTGAAGGTACAGGGAAGAAGG + Intergenic
1069607058 10:69745873-69745895 AAGTGAAACCACAGAGAAGAGGG - Intergenic
1070496354 10:77027579-77027601 GAGTGTTTCTCCAGGGAAGAGGG - Intronic
1076021429 10:127076909-127076931 CAGTGAAACTCCAGGCAAGAAGG - Intronic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078291465 11:10014636-10014658 TAATGTAACCACACTGAAGAGGG - Intronic
1078659259 11:13273436-13273458 TAATGTAAGTACAGGGTAGGGGG + Intergenic
1079794625 11:24785066-24785088 TAGTGTAACTACAGGGAAGAAGG - Intronic
1079869258 11:25776032-25776054 TATTGCAACTAGAGGGAAAATGG + Intergenic
1083129523 11:60611746-60611768 TAGCTTACCTACAGTGAAGAAGG + Intergenic
1084298356 11:68227825-68227847 CTGTGTAACTACTGTGAAGAGGG - Intergenic
1086443860 11:86853862-86853884 TGGTGAAACTAGAGGGAAGTAGG - Intronic
1088863167 11:113821142-113821164 TATTGAAGATACAGGGAAGATGG - Intronic
1091653592 12:2327715-2327737 CAGCGTAATTACAAGGAAGATGG + Intronic
1096377906 12:51129588-51129610 TAGAGTAACTAAAGGGAAAGAGG + Intronic
1103176782 12:118871081-118871103 TAGTTTAACAACTGGGAAGATGG - Intergenic
1104652578 12:130546884-130546906 AAGTGAAACTACAGGGAAATAGG - Intronic
1104797247 12:131528297-131528319 GAGTAGAACTTCAGGGAAGAGGG + Intergenic
1105213615 13:18272159-18272181 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1107740530 13:43445489-43445511 TAGTGTTAAAACAGGGAACATGG + Intronic
1108399942 13:50030624-50030646 GTGTGTAACTACATGGAAAATGG + Intergenic
1108879533 13:55092729-55092751 TAGTGTAAGTGCAGGGATAAGGG + Intergenic
1109212347 13:59548616-59548638 TAGTCCAACTCCAGGGAAGCGGG - Intergenic
1109839770 13:67906374-67906396 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1111062699 13:83044244-83044266 TAGTATAAGTAAAGGGAAAATGG + Intergenic
1111464059 13:88585152-88585174 TAGTTTTACTTCAGTGAAGAGGG + Intergenic
1111782776 13:92750634-92750656 TAGTGTAACTACCAGGAGTAGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1115857051 14:37641560-37641582 TAGTCTCACCACAGTGAAGAGGG + Intronic
1117040974 14:51768598-51768620 TGGTGAAACTAAAGGGAAGTAGG - Intergenic
1117172129 14:53111441-53111463 CACGTTAACTACAGGGAAGAAGG - Intronic
1117373246 14:55097732-55097754 TAGTGGAATTACAGGCAATAGGG - Intergenic
1118091542 14:62485798-62485820 AAGTGTAACTAAAGGGGAGATGG - Intergenic
1118523895 14:66618829-66618851 AATTGTAACTACATGGAAGATGG + Intronic
1118991537 14:70801361-70801383 TATTGTCACTAAAGGGAATATGG + Intronic
1120852406 14:89183433-89183455 TAAGGTAACTACAAGCAAGAGGG + Intronic
1121252784 14:92512565-92512587 TGGTGGAAATCCAGGGAAGATGG + Intergenic
1123709450 15:22976496-22976518 TAATGAAACTACAGGTAAGTGGG - Intronic
1124995082 15:34715887-34715909 GAGTTAAACTACAGGGAAGGTGG + Intergenic
1127403136 15:58612420-58612442 TAGTCTAGCTCCAGGGAAGCAGG - Intronic
1131573670 15:93564797-93564819 TAGTGGAAATACAGAGATGAGGG + Intergenic
1133085167 16:3356551-3356573 TAGTGGGACTGCAGTGAAGAAGG - Exonic
1140733003 16:77873196-77873218 TAGTTTAACTCCAGAGATGATGG - Intronic
1140733551 16:77877646-77877668 TATTGTACCTACAGGGGACAAGG - Intronic
1141837060 16:86548198-86548220 TATTGTAAGAAAAGGGAAGACGG - Intronic
1142995864 17:3760014-3760036 CAGGGTAACTCCAGGCAAGATGG + Intronic
1143996996 17:11015220-11015242 TAGTATAACCTCAGGGAAAATGG - Intergenic
1145256163 17:21323627-21323649 GAGTGTAACGACACGGAACATGG + Intergenic
1145320451 17:21764324-21764346 GAGTGTAACGACACGGAACATGG - Intergenic
1146658811 17:34651228-34651250 GAGTGAGACTACTGGGAAGATGG - Intergenic
1146839057 17:36136879-36136901 TAGGATAACCACAGGGAAGCAGG + Intergenic
1149242781 17:54669780-54669802 TAGTCTCACTAAAGGCAAGAAGG + Intergenic
1150325766 17:64256135-64256157 TAGCGTAACCATAGGGCAGAAGG - Intronic
1151118734 17:71768243-71768265 TAGTGTAACAGTTGGGAAGAGGG - Intergenic
1151484360 17:74389302-74389324 TTGTGTAACTGTAGGGGAGAGGG + Intergenic
1154137005 18:11788455-11788477 GAGTGTAAGTACAGAGAAAATGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155772457 18:29719528-29719550 CAGTGTAACTCCATTGAAGAAGG + Intergenic
1159459804 18:68710576-68710598 TATTGTAACCACTGGCAAGAAGG + Intronic
1164631734 19:29766269-29766291 GAGTGTCACTGCAGGGAGGAGGG - Intergenic
1165211532 19:34239943-34239965 TAGTGAAAGTACAGGGAGGATGG - Intergenic
1167033200 19:46977287-46977309 TAGTGAAGTTACCGGGAAGAAGG + Intronic
925228397 2:2206900-2206922 TAGTGTCCCTACATGCAAGAAGG + Intronic
925395470 2:3530227-3530249 TAGTAGTACTACGGGGAAGAAGG + Intergenic
930747643 2:54901292-54901314 TAGTGTAAAGACAGGCAACACGG - Intronic
930983088 2:57551440-57551462 TAGGCTAACCACAGAGAAGATGG - Intergenic
932348257 2:71010210-71010232 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
932351134 2:71033090-71033112 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
932528980 2:72505565-72505587 TAGTTTTATTATAGGGAAGATGG - Intronic
934300713 2:91774587-91774609 AGGTGTGACAACAGGGAAGAGGG - Intergenic
934583727 2:95469484-95469506 TCGTGGAAATACAGGGAAGAAGG + Intergenic
934595725 2:95607230-95607252 TCGTGGAAATACAGGGAAGAAGG - Intergenic
939560456 2:143725585-143725607 TTGTGGAACCACAGGGAAGGAGG - Intronic
940250364 2:151669112-151669134 TAGTTGAACTACAAGGTAGAGGG - Exonic
940379895 2:153002101-153002123 TATTGAAAAGACAGGGAAGAAGG + Intergenic
940769291 2:157823560-157823582 AAGTGGAAATACAGTGAAGATGG + Intronic
940833387 2:158493459-158493481 TAGGGTAACCACATGGAAAATGG - Intronic
940870677 2:158857732-158857754 TGGTGAAACTAGAGGGAAGTAGG + Intronic
941522041 2:166557538-166557560 TTGTGTTACTACAGGAATGAAGG - Intergenic
945641283 2:212433903-212433925 TAGTGTCATTACATGGAAGAGGG + Intronic
947631728 2:231657911-231657933 TGCTGTCACTACAGGCAAGATGG + Intergenic
948003174 2:234584929-234584951 TATCGTACCCACAGGGAAGATGG + Intergenic
1169105200 20:2988494-2988516 TGGTGTATCAGCAGGGAAGAAGG + Intronic
1169740811 20:8892272-8892294 TAGAGTAAATACAGAGATGAGGG - Intronic
1169948599 20:11016166-11016188 TAGTATAACAGAAGGGAAGAAGG - Intergenic
1170758729 20:19230357-19230379 TATTCTAACTACAAGGTAGAAGG - Intronic
1170932693 20:20783037-20783059 TATTTTACTTACAGGGAAGAGGG + Intergenic
1175672257 20:60914457-60914479 AATTGTAACTGCAGGTAAGAAGG - Intergenic
1176069951 20:63221013-63221035 GAGTGCAGGTACAGGGAAGACGG + Intergenic
1177297963 21:19201813-19201835 TAGAGGAACTACAGGGGAGCAGG - Intergenic
1177667099 21:24174565-24174587 TAATGTAATCACAGGGAAGAGGG - Intergenic
1180816449 22:18792550-18792572 AGGTGTGACAACAGGGAAGAGGG + Intergenic
1181202636 22:21226882-21226904 AGGTGTGACAACAGGGAAGAGGG + Intronic
1181699067 22:24609723-24609745 AGGTGTGACAACAGGGAAGAGGG - Intronic
1184575354 22:45359950-45359972 CTGTGTAATTACAGGGAAGTGGG - Exonic
1203224277 22_KI270731v1_random:68531-68553 AGGTGTGACAACAGGGAAGAGGG - Intergenic
1203266549 22_KI270734v1_random:18261-18283 AGGTGTGACAACAGGGAAGAGGG + Intergenic
949880049 3:8654495-8654517 CAGTGTAACTGCAGGGAAGTAGG - Intronic
949885736 3:8692312-8692334 TGGTGAAACTAGAGGGAAGTAGG + Intronic
950209814 3:11114577-11114599 TAGTATAACAACAGGGAGGGTGG - Intergenic
952094979 3:29940010-29940032 TGGTTTGACTACAGGGAAAATGG - Intronic
952168354 3:30776722-30776744 CAGTCTAACTAGAAGGAAGAGGG - Intronic
953727611 3:45414058-45414080 AAGTGCAACTACAGGGTAAAAGG - Intronic
953842377 3:46399441-46399463 TAGTGAAACTGCCTGGAAGAGGG + Intergenic
953970144 3:47340942-47340964 TAATGGAAATACAGGCAAGAGGG + Intronic
957043250 3:75353338-75353360 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
958572598 3:95906993-95907015 TACTGTATCCACAGGGAAGTTGG - Intergenic
960701989 3:120448682-120448704 CAGGCAAACTACAGGGAAGAAGG - Intronic
961273397 3:125707512-125707534 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
967868039 3:194206351-194206373 GAGAGAAACTACAAGGAAGAAGG + Intergenic
968952946 4:3703981-3704003 TGGGATAATTACAGGGAAGAGGG - Intergenic
969026793 4:4179635-4179657 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
970334059 4:15014836-15014858 TAGTGGAAGCACAGGGAAGATGG + Intronic
974965711 4:68758721-68758743 TGGTATAATTACAGGTAAGATGG + Intergenic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
977478985 4:97549682-97549704 AAGGGCAACTACAGAGAAGAAGG + Intronic
977676780 4:99756895-99756917 TTGTGTGACTAGAGGGAAGCTGG + Intergenic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
979677845 4:123429196-123429218 TAGGGTAAGTGGAGGGAAGATGG + Intergenic
980244684 4:130223981-130224003 TAGTCTAGCTTCAGGGAAGCAGG + Intergenic
981625337 4:146748191-146748213 TGGTGTATCTCCAGGGAAGAAGG - Intronic
982103279 4:151989523-151989545 CTGTGTAACCACAGGGAAGCAGG - Intergenic
982115051 4:152091545-152091567 TATTGTAAATATAGGGAATATGG - Intergenic
984231801 4:177109379-177109401 GAGTGTTCCTACAGGCAAGAGGG + Intergenic
988222006 5:28358749-28358771 TAGTGTGTCTCCAGGGAACATGG + Intergenic
990972089 5:61519320-61519342 TGGTGTAAGCACAGGGAAAAAGG - Intronic
990972480 5:61524273-61524295 TAGTGAAACTGCAAGGGAGAAGG - Intronic
993076886 5:83243420-83243442 AAGTGTATGTACAGAGAAGAAGG - Intronic
993247102 5:85465107-85465129 TAGTGTAACTCCAGACATGAAGG + Intergenic
994782660 5:104112253-104112275 TAGTGTAACTGCTGAGAAAATGG - Intergenic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
996226646 5:121007427-121007449 TGGTGGAACAACAAGGAAGATGG + Intergenic
997194971 5:131973290-131973312 TCGTGGGACCACAGGGAAGATGG + Exonic
1003267465 6:4578737-4578759 TAAGTTAACTACAGTGAAGAAGG + Intergenic
1003318743 6:5034294-5034316 TTGTGAAACTACAGAAAAGAAGG + Intergenic
1005817232 6:29563540-29563562 TACTGAAACTAGAGGCAAGAGGG + Intronic
1012238843 6:96849530-96849552 TAGTGAGGCTGCAGGGAAGAGGG + Intergenic
1015309653 6:131752472-131752494 TAATGTAACTACACTGAAGGGGG - Intergenic
1016154188 6:140783278-140783300 GAGTGTAACAAGAGGGAAGGAGG + Intergenic
1016763102 6:147762080-147762102 TATTGTAGCTACAGTTAAGATGG - Intergenic
1019755244 7:2763944-2763966 TAGTGTTGCTATAGGAAAGAAGG - Intronic
1020646117 7:10816254-10816276 TAGAGTAACTAAAAGGAGGATGG + Intergenic
1022683552 7:32573112-32573134 CAGAGTAACTACGGGGAAGGTGG - Intronic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1024001109 7:45189855-45189877 TGGGGTAACTGAAGGGAAGAAGG + Intergenic
1025218603 7:57083612-57083634 TAGTGTAACTACTAAGAATAAGG + Intergenic
1025629524 7:63257207-63257229 TAGTGTAACTACTAAGAATAAGG + Intergenic
1025652745 7:63486827-63486849 TAGTGTAACTACTAAGAATAAGG - Intergenic
1027537226 7:79418634-79418656 TGGTCTTTCTACAGGGAAGAAGG + Intronic
1030327885 7:108240702-108240724 GAGGGTGACTACAGGGAGGAAGG - Intronic
1034471489 7:151256975-151256997 TGGGGGAACTCCAGGGAAGAGGG - Intronic
1035854877 8:2964099-2964121 TTGTGTATCTTCAGAGAAGAAGG - Intronic
1039612187 8:38928839-38928861 AAGTGGACCTACAGGGCAGAGGG + Intronic
1040988948 8:53328355-53328377 GGGAGTAACTGCAGGGAAGAGGG - Intergenic
1041037500 8:53809452-53809474 GAGAGTCACTAAAGGGAAGAAGG + Intronic
1041853348 8:62419087-62419109 TAGTCTAACTAAAGGGACGTAGG + Intronic
1043921511 8:85988973-85988995 TGGTGAAGCTACAGGGCAGAGGG - Intronic
1044047795 8:87459582-87459604 AAGTGCAACTACTGGGAAGGGGG + Intronic
1044463797 8:92480273-92480295 TAGTTTAGCTCCTGGGAAGAAGG - Intergenic
1044640571 8:94376484-94376506 TAGAGTAAATACAAGGAAAAAGG + Intronic
1048019405 8:130524680-130524702 TACGGTAACCACAGGGAAGGAGG + Intergenic
1049649005 8:143754942-143754964 TAACGTAACTACAGGAATGATGG + Intergenic
1050048966 9:1577812-1577834 TGTTGTACCTACAGGGAAGATGG + Intergenic
1050930655 9:11320176-11320198 TATTGTGACTACAGAGAAAAGGG + Intergenic
1051044373 9:12855790-12855812 AAGTATTACTACAGGGAAGCAGG + Intergenic
1051749498 9:20326467-20326489 AAGATTAACTCCAGGGAAGAGGG - Intergenic
1052348291 9:27432105-27432127 AAGTTTAATTAAAGGGAAGAAGG + Intronic
1054871911 9:70054841-70054863 TACTGTAAATACAGGGGAGGTGG + Intronic
1056617029 9:88177601-88177623 TAGTCTCAATAGAGGGAAGAAGG + Intergenic
1056836865 9:89962548-89962570 TAGTGTCACTACAGAGTTGATGG + Intergenic
1056863739 9:90211397-90211419 TGGTGAAACTAGAGGGAAGTAGG + Intergenic
1056916169 9:90748047-90748069 TGGTGAAACTAGAGGGAAGTAGG - Intergenic
1057055112 9:91954478-91954500 TTGTGGAACTACACGGATGATGG - Intergenic
1057770693 9:97965198-97965220 GGGTGTATCTGCAGGGAAGAGGG - Intergenic
1059784008 9:117560867-117560889 TAGTGAGACTGCAGAGAAGAGGG + Intergenic
1060161031 9:121364387-121364409 TAGAGTAGCTACAGGCCAGATGG + Intronic
1189518727 X:41743267-41743289 TAGTGAAACTCAATGGAAGAAGG - Intronic
1191221396 X:57991342-57991364 TAGTGTAGCTTCAGGGAAGCAGG + Intergenic
1194044466 X:88984463-88984485 TAGAGTAACTAGAGGCAAGGAGG + Intergenic
1195946373 X:110217302-110217324 TTGTGAAACTACAGGAAATAGGG + Intronic
1196388133 X:115181179-115181201 CAGTGTAACTAGAGGGAAATGGG + Intronic
1200909976 Y:8523419-8523441 TAGGGTCACTACATGGAAAATGG - Intergenic
1200955098 Y:8936971-8936993 TAGGGTCACTACATGGAAAATGG - Intergenic
1202195078 Y:22291741-22291763 TAGGGTCACTACATGGAAAATGG + Intergenic
1202199920 Y:22335725-22335747 TAGGGTCACTACATGGAAAATGG - Intronic