ID: 1079795573

View in Genome Browser
Species Human (GRCh38)
Location 11:24798709-24798731
Sequence AATGGCAAGCAGGGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 303}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079795573_1079795582 10 Left 1079795573 11:24798709-24798731 CCTGCTTCCCCCTGCTTGCCATT 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1079795582 11:24798742-24798764 AAGGGATTCCCTAGAGCCTGTGG 0: 1
1: 0
2: 0
3: 28
4: 201
1079795573_1079795583 11 Left 1079795573 11:24798709-24798731 CCTGCTTCCCCCTGCTTGCCATT 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1079795583 11:24798743-24798765 AGGGATTCCCTAGAGCCTGTGGG 0: 1
1: 0
2: 1
3: 16
4: 278
1079795573_1079795587 26 Left 1079795573 11:24798709-24798731 CCTGCTTCCCCCTGCTTGCCATT 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1079795587 11:24798758-24798780 CCTGTGGGAGAGTTGACATAAGG 0: 1
1: 0
2: 0
3: 7
4: 118
1079795573_1079795579 -9 Left 1079795573 11:24798709-24798731 CCTGCTTCCCCCTGCTTGCCATT 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1079795579 11:24798723-24798745 CTTGCCATTAAGAGAGGAGAAGG 0: 1
1: 0
2: 0
3: 19
4: 201
1079795573_1079795580 -8 Left 1079795573 11:24798709-24798731 CCTGCTTCCCCCTGCTTGCCATT 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1079795580 11:24798724-24798746 TTGCCATTAAGAGAGGAGAAGGG 0: 1
1: 1
2: 1
3: 36
4: 280
1079795573_1079795588 27 Left 1079795573 11:24798709-24798731 CCTGCTTCCCCCTGCTTGCCATT 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1079795588 11:24798759-24798781 CTGTGGGAGAGTTGACATAAGGG 0: 1
1: 0
2: 0
3: 11
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079795573 Original CRISPR AATGGCAAGCAGGGGGAAGC AGG (reversed) Intronic
900326675 1:2111591-2111613 AATGGCAGGCGGGGCGCAGCAGG - Intronic
900826072 1:4928020-4928042 AAAGGCAAGAAGAGTGAAGCTGG - Intergenic
901391166 1:8947251-8947273 TATGGAAAGAAGGGGGATGCGGG - Intronic
902914392 1:19627739-19627761 AAAGGCATGGAGGGGGAGGCTGG + Exonic
903028054 1:20443464-20443486 ATTGCCAGGCAGGGGGATGCAGG - Intergenic
904286197 1:29454590-29454612 AGGGTGAAGCAGGGGGAAGCAGG + Intergenic
904317080 1:29672510-29672532 AAAGGCAAGCAGGAGGAAAAGGG + Intergenic
905461940 1:38127828-38127850 AATGGCAAGGAGGAGGAGGGTGG - Intergenic
905895426 1:41542847-41542869 AATGGCTATCAGTGGGATGCAGG + Intronic
905913013 1:41666730-41666752 AATGGATTGCAGGGGTAAGCTGG - Intronic
906382693 1:45342853-45342875 AATGGGAAGCAGCGGGCAGCTGG + Exonic
908778125 1:67661449-67661471 AATGAAAAGCAGGGGGAGGGTGG - Intergenic
909895138 1:81059188-81059210 AAAGGAAAGCATGGGGAAGTTGG - Intergenic
910065117 1:83142998-83143020 AATGACAAGCAGTGGGGACCAGG + Intergenic
910547848 1:88439300-88439322 AGTGGGAAGCAGGGGGAAGTGGG + Intergenic
910665755 1:89724563-89724585 TTGGGCAAGCAGGGGGAACCTGG + Intronic
911452596 1:98083894-98083916 AATAGGAAGAAGGGGGAAGACGG - Intergenic
911504244 1:98728617-98728639 AATGGAAAGCAGGAACAAGCAGG + Intronic
912201396 1:107461936-107461958 GATTGCAAGCAGGGGCAAGAAGG + Intronic
913410437 1:118544828-118544850 AATGGAAAGCAGGAAAAAGCAGG + Intergenic
915967419 1:160323182-160323204 AATGGGAAGGAGGGTGAAGGAGG + Intronic
916449952 1:164911196-164911218 GATGGCAAGCAGGCTGGAGCAGG + Intergenic
917999563 1:180479490-180479512 AGGGGCAAGTAGGGGGAAGAGGG + Intronic
918511324 1:185316998-185317020 GATGGGAAGCAGGAGGAAGCGGG + Exonic
919799510 1:201344937-201344959 AATGGGAAGCAGCAGGAGGCAGG - Intergenic
920097721 1:203497407-203497429 AATAGCATGACGGGGGAAGCAGG + Intronic
920205590 1:204288611-204288633 GATGGGAAGCAGTGGGAAGGTGG + Intronic
920443479 1:205997860-205997882 AAAGGCAGGCAGGAAGAAGCGGG + Intronic
920694323 1:208170405-208170427 ATTGACAGGCAGGGGGAAGCAGG + Intronic
921164189 1:212494316-212494338 AATGGCAGGCAGGAGGTGGCGGG + Intergenic
922227165 1:223655474-223655496 CATGGCAGGCAGGGGAAAGAGGG + Intronic
922900110 1:229130076-229130098 AATGGCACAGAGGAGGAAGCTGG + Intergenic
922935667 1:229420297-229420319 CAAGGCAGGCAGGTGGAAGCAGG - Intergenic
923102313 1:230826378-230826400 GGTGGCATGCAGGAGGAAGCAGG + Intergenic
923252399 1:232189733-232189755 AATGCCAAGCAAGGAGAATCAGG + Intergenic
923940377 1:238816850-238816872 GATGGATAGCTGGGGGAAGCAGG - Intergenic
924893810 1:248314715-248314737 AATGGAAAGCAAAGGAAAGCAGG - Intergenic
1062823461 10:551470-551492 AAGGGAAAGCAGCTGGAAGCAGG + Intronic
1062857759 10:787948-787970 AATGGCAAAGAGGCGGGAGCAGG + Intergenic
1064228828 10:13511554-13511576 AAAGTCAAGCAGGGAGATGCTGG + Intronic
1065359087 10:24872257-24872279 AATGGCTGGCAGGGAGAGGCTGG + Intronic
1066058765 10:31704290-31704312 AATGGGGAGCAGTGGGAAGGGGG + Intergenic
1067152010 10:43743640-43743662 AATGGCAAGCAGTGGATACCTGG - Intergenic
1067720146 10:48722047-48722069 ACTGGCTAGCAGGTAGAAGCTGG - Intronic
1068060743 10:52064585-52064607 ATGGGCAGGCAGGGGGAAGCAGG - Intronic
1069788998 10:71007431-71007453 AATGGGACCCAGGGAGAAGCAGG + Intergenic
1071718462 10:88120049-88120071 AGCGGGAAGGAGGGGGAAGCAGG + Intergenic
1072096058 10:92181479-92181501 AATGGCAACCAGAAGGAAGACGG + Intronic
1073092168 10:100951406-100951428 AATGGCAGTCAGGTGGCAGCAGG + Intronic
1075174006 10:120142839-120142861 AAGGGAAGGCAGGGAGAAGCAGG - Intergenic
1076868430 10:133181017-133181039 AATTCCAAGAAGGGGGATGCTGG - Intronic
1077485042 11:2834755-2834777 AATGCCAGGCAGGGCCAAGCTGG + Intronic
1077798603 11:5516461-5516483 GATGGGGAGCAGGTGGAAGCTGG + Exonic
1079795573 11:24798709-24798731 AATGGCAAGCAGGGGGAAGCAGG - Intronic
1082075545 11:47973418-47973440 AGTGGCAAGCAGTGGGCAGGAGG - Intergenic
1083643336 11:64157637-64157659 AAAGCCAAGCAGGAGGAAGCAGG + Intronic
1083769375 11:64857871-64857893 CATGGCATGCAGGGGGTACCAGG - Intronic
1083922483 11:65788089-65788111 AAGGGCAAGCGGGGCGCAGCGGG - Intronic
1084021018 11:66418356-66418378 AATAGCAAGCAGGAGGAGGGGGG - Intergenic
1084945108 11:72634161-72634183 AAGGGGCAGCAGGAGGAAGCGGG + Intronic
1085497552 11:76984964-76984986 AATGGCAAAAAGAGGGAAGGGGG - Intronic
1088066368 11:105725588-105725610 ATTGGAAAGCAGGGGCAAGATGG + Intronic
1088347368 11:108842914-108842936 GATGGCAAGGAAGGGGAAGAGGG - Intronic
1088562229 11:111126867-111126889 GATTGTAAGCTGGGGGAAGCGGG - Intergenic
1088675518 11:112188708-112188730 GATGGAAAGCTGGGGGAATCAGG - Intronic
1089356618 11:117858133-117858155 GATGGGAAGCAGGGGGACGCTGG - Intronic
1090332238 11:125941389-125941411 AATGGAAAGCAGATGGAAGGAGG + Intergenic
1091591402 12:1845060-1845082 AGTGGGAGGCAGGGAGAAGCAGG + Intronic
1091891116 12:4055368-4055390 AAGGGAGAGCAGGGGGAAGCTGG - Intergenic
1092910936 12:13144470-13144492 AATGGCAGGCAGGGAGGAGGAGG + Intergenic
1092937111 12:13374429-13374451 AATTGCAACCATGTGGAAGCTGG + Intronic
1092955172 12:13542915-13542937 AATGGCAATGAGGGGCAAGAAGG - Exonic
1094157207 12:27349884-27349906 AATGGCAAGAAGGCAGCAGCAGG - Intronic
1095473972 12:42566211-42566233 AATGGAGGGAAGGGGGAAGCTGG + Intronic
1095653908 12:44647138-44647160 AATGCCAAGGAGTGGGTAGCAGG + Intronic
1100768496 12:97896116-97896138 AATGGAAAGCAGGAAAAAGCAGG - Intergenic
1100931139 12:99610583-99610605 AATGGGAAGCAGGAGAAAGAAGG + Intronic
1103573097 12:121857746-121857768 AACGCCAAGCAGGTAGAAGCCGG - Exonic
1103728882 12:123013039-123013061 ACTGCCAAGCAGGAGGAAGCTGG + Intronic
1104717774 12:131027733-131027755 CATGGCTGGCAGGGGGATGCAGG - Intronic
1107243908 13:38269308-38269330 AATGGAAAGCAGAGAAAAGCAGG + Intergenic
1108059346 13:46517278-46517300 AATGTCAAGGAATGGGAAGCTGG + Intergenic
1110836698 13:80091919-80091941 AATGGAAAGCAGAAGAAAGCAGG - Intergenic
1111068204 13:83125819-83125841 CAAGGCAAGAAGGGAGAAGCTGG + Intergenic
1112371402 13:98796898-98796920 TACGGCAAGCAGGGGAGAGCGGG - Intronic
1112576473 13:100640898-100640920 AATGGAAAGCAATGGAAAGCAGG + Intronic
1116080804 14:40168692-40168714 AAAGGCGAGCTGGGGCAAGCTGG + Intergenic
1117639073 14:57777793-57777815 AAAGGCAAACAGTGGCAAGCCGG + Intronic
1118357530 14:65027071-65027093 AAAGGCAAGGAGGAGGAGGCTGG + Intronic
1119319487 14:73721247-73721269 CAGGGCAAGCAGGGTGGAGCTGG - Intronic
1119423963 14:74524137-74524159 GATGGGAAGCAGGGGGCAGGGGG - Intronic
1119651917 14:76390034-76390056 AATGGCCAGCTGGGGGACGGCGG - Intronic
1120799406 14:88671719-88671741 AATGGAAAGCAGGAAAAAGCAGG + Intronic
1120913673 14:89690743-89690765 AAGGGCAAAGAGGAGGAAGCAGG + Intergenic
1121396883 14:93632878-93632900 AATGGCAAGGAGGAGAAAGGTGG - Intronic
1122764057 14:104053054-104053076 GCTGGCCAGCAGCGGGAAGCTGG + Intergenic
1123402527 15:20002802-20002824 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1123511865 15:21009456-21009478 CATGGTGAGCAGGGGGAAGAAGG + Intergenic
1124860006 15:33430221-33430243 AATGCCAAGCAAGGAGAATCGGG + Intronic
1126753028 15:51896716-51896738 CATAGGAAGGAGGGGGAAGCTGG - Intronic
1128300219 15:66561998-66562020 CATGGCAAAGAGGGGGAAGCTGG - Intronic
1129271657 15:74422258-74422280 GATGGGAAGCAGGGGGAGCCAGG - Intronic
1129773515 15:78218047-78218069 AATGGCAAGCAATGGGGAGATGG - Intronic
1131949399 15:97664608-97664630 AAAGGCAAGAAGAGGCAAGCTGG - Intergenic
1131989484 15:98079722-98079744 AAAGGGAAGCATGGGGAAGAAGG - Intergenic
1132057029 15:98660088-98660110 AAAGGCAATCATGGGGAAACAGG - Intronic
1132370777 15:101296343-101296365 AATGCCAAGAAGGCTGAAGCTGG - Intergenic
1132431685 15:101766341-101766363 AAAAGCAAGCAGAGAGAAGCAGG - Intergenic
1132461368 16:56759-56781 AATGGCAGGCAGAGGGCAGCTGG + Intronic
1133827240 16:9289121-9289143 AATGGAAAGGATGTGGAAGCAGG + Intergenic
1135259424 16:20968023-20968045 AATGCTAAGCAATGGGAAGCAGG + Intronic
1135758662 16:25118719-25118741 AATGTCCAGCAGAGAGAAGCAGG + Intronic
1135913868 16:26586032-26586054 CATGGGAAGCAAGGGGAAGAGGG - Intergenic
1135948866 16:26893153-26893175 AATGACAAGCAGGAGGGGGCTGG - Intergenic
1136012447 16:27372588-27372610 AAAGGCCAGCAGAGGGAGGCAGG - Intergenic
1136556129 16:31009051-31009073 AATGGGAAGCAAGGAGGAGCTGG - Intronic
1137056053 16:35747171-35747193 TATGACAAGCAGGGGAAAGCGGG - Intergenic
1137370322 16:47899159-47899181 AATGGAAAGCAGAGAAAAGCAGG + Intergenic
1137587863 16:49674895-49674917 AAGGGCAAGATGGAGGAAGCAGG - Intronic
1138849039 16:60604785-60604807 CATGGCAGGCAGGAGGAAGAGGG + Intergenic
1141506561 16:84482103-84482125 CACAGGAAGCAGGGGGAAGCGGG - Intronic
1141609713 16:85174522-85174544 AATGGGAAGGAGGGGGAGGGAGG - Intronic
1143185933 17:5010309-5010331 AATGTCCATCAGTGGGAAGCTGG - Intronic
1144215122 17:13048693-13048715 AATGCCATGCATGAGGAAGCTGG + Intergenic
1146458239 17:33023824-33023846 CATGGTAGGCAGGGGGAAGGGGG - Intronic
1147466657 17:40616060-40616082 AGTGGGAAGCAGGGAGAATCTGG + Intergenic
1147659564 17:42110324-42110346 AATGACAAGGAGGAGGCAGCAGG + Intronic
1148776275 17:50097190-50097212 AAAGGCAAGCAGGGTTCAGCTGG + Intronic
1150319658 17:64201919-64201941 TATGGGAAGCAGGAGTAAGCAGG + Intronic
1151629193 17:75298695-75298717 GATGGCAGGCAGGGTGAAGATGG - Intergenic
1152195954 17:78918473-78918495 AGTGGCAGGCAGGATGAAGCTGG - Intronic
1152446496 17:80347766-80347788 AATGACAATCAGGCGGAAGTTGG - Exonic
1152766778 17:82145733-82145755 AGGGGCCTGCAGGGGGAAGCAGG - Intronic
1152882285 17:82825180-82825202 AATGACAAATAGGGAGAAGCAGG - Intronic
1153585091 18:6612695-6612717 AAAGGCAAGAATGGGGAAACCGG - Intergenic
1153788296 18:8554647-8554669 AATGGCAGGCAGGTAGGAGCAGG + Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1154201218 18:12302032-12302054 AAAGCCCAGCAGGGGCAAGCTGG - Intergenic
1155118475 18:22793985-22794007 AATGGCAGGCAAGGGGTTGCTGG - Intergenic
1155688704 18:28589134-28589156 ATTGGCAAGCCAGGAGAAGCTGG + Intergenic
1158931134 18:62325607-62325629 AAGGGCAAGCGGAGGGAAACTGG + Intronic
1161820164 19:6525706-6525728 AATGGCAGGTAGTGGGAAACAGG - Intergenic
1164803594 19:31098698-31098720 CATGGGAACCAGGAGGAAGCAGG - Intergenic
1165117747 19:33539055-33539077 CATGCCAGGCAGGTGGAAGCTGG - Intergenic
1165674062 19:37706271-37706293 AAAGGAAAGGAGGGGGAAGGGGG + Intronic
1166139953 19:40800273-40800295 ACAGGCAGGCAGGGGAAAGCCGG - Exonic
1166484833 19:43203963-43203985 AATGTCACGCAGGAGGATGCAGG - Exonic
1168710608 19:58497981-58498003 AAGGGCAAGCAGGAGGTAACTGG - Intronic
925466394 2:4110463-4110485 ACTGACAGGCAGGGGGCAGCAGG - Intergenic
926395285 2:12435015-12435037 AGAGGGAAGCAGGGAGAAGCAGG - Intergenic
927143289 2:20144212-20144234 AATGGCAATCAGAGAGAAACTGG + Intergenic
929554962 2:42920487-42920509 CATGCCAAGCAGAGGGAAGGAGG - Intergenic
929766490 2:44848181-44848203 AATGGGGAACAGGAGGAAGCTGG - Intergenic
929825289 2:45305297-45305319 CATGGCAAGCAGTAGGCAGCAGG - Intergenic
930552236 2:52850648-52850670 AATGGAAAGCAGAAGAAAGCAGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
933534561 2:83556128-83556150 AATGGAAAGCAGAAGTAAGCAGG - Intergenic
933607495 2:84398893-84398915 AATGGAAAGCAGAAGAAAGCAGG + Intergenic
933786921 2:85850537-85850559 AATGCCAAGCTGGTGGAAGCGGG + Intronic
933828222 2:86183638-86183660 TATGGCAAGCATGGGGTGGCTGG - Intronic
938672928 2:133602735-133602757 CATGGCCAGCAGGCTGAAGCTGG - Intergenic
939162281 2:138604760-138604782 AAAGGCAAGGAGGAGGAGGCAGG + Intergenic
940198858 2:151127788-151127810 AATGGAAAGAGGGGGGAAGATGG + Intergenic
943043463 2:182830171-182830193 AATGAAAAGCAGGGGGAATTAGG + Intergenic
943152865 2:184136639-184136661 AATGGGAAACAGAGGAAAGCAGG - Intergenic
944047647 2:195431366-195431388 GATGGAAGGCAAGGGGAAGCAGG - Intergenic
947005415 2:225505881-225505903 AATGGGAAGAAGGATGAAGCAGG + Intronic
947118898 2:226797585-226797607 GAAGGCGAGCAGCGGGAAGCCGG + Exonic
947232634 2:227903373-227903395 AAAGGAAAGCAGGTGGAGGCTGG + Intronic
947317085 2:228871916-228871938 AATGGCAAGCAGGAAAACGCAGG - Intronic
947670206 2:231930922-231930944 TTTGGCAAGCAGGGGAAAGGAGG - Intergenic
947750894 2:232531481-232531503 GCTGGCAAGCAGGGTGAGGCCGG - Intronic
948125779 2:235563920-235563942 CATGGCTATCAGTGGGAAGCTGG + Intronic
1171119942 20:22559323-22559345 AATTGGTTGCAGGGGGAAGCAGG + Intergenic
1171162584 20:22941418-22941440 CATGAAAAGCAGGGGGCAGCAGG + Intergenic
1171245801 20:23608665-23608687 AATGCCAAGCAGGGGGAATGGGG - Intergenic
1172814690 20:37677065-37677087 CTTGGCAAGCAGGGGGCTGCAGG + Intergenic
1173246304 20:41340163-41340185 ACTGGCCAGCAGGGGGCAGGCGG - Intergenic
1173815593 20:45985736-45985758 AATGGAAGGCAGGAGGAGGCAGG + Intergenic
1174951829 20:55050793-55050815 GATGGGAAGGAGAGGGAAGCGGG + Intergenic
1175401403 20:58701617-58701639 AATGGCAAGCAGGGCCAGGGAGG + Intronic
1175999314 20:62824983-62825005 AAAGGCGAGCAGGGGGAAGTCGG + Exonic
1176345697 21:5744405-5744427 AAAGGCAAACAGTGGGAAACTGG - Intergenic
1176352511 21:5864989-5865011 AAAGGCAAACAGTGGGAAACTGG - Intergenic
1176499130 21:7580050-7580072 AAAGGCAAACAGTGGGAAACTGG + Intergenic
1176540018 21:8142475-8142497 AAAGGCAAACAGTGGGAAACTGG - Intergenic
1176558969 21:8325520-8325542 AAAGGCAAACAGTGGGAAACTGG - Intergenic
1178222681 21:30677979-30678001 AAAGGCAACCAGGGGCAAGTGGG + Intergenic
1178824614 21:36004931-36004953 GAGGGGAGGCAGGGGGAAGCAGG + Intergenic
1179406771 21:41132669-41132691 ACTGGCAAGCAGGGAGGAGCTGG + Intergenic
1179812976 21:43884241-43884263 AGGGGGAAGGAGGGGGAAGCGGG - Intronic
1181633547 22:24163871-24163893 GATGGCAAGAAGTGGGAAGAGGG + Intronic
1181850790 22:25748626-25748648 AATGGCGGGCAGGGAGCAGCAGG - Intronic
1182005352 22:26955211-26955233 AATGACAGGCAGTGGTAAGCAGG - Intergenic
1182487224 22:30646790-30646812 GAGGGCCAGCAGGGAGAAGCTGG - Exonic
1184323064 22:43757752-43757774 AAAGGGAAGCAGGCTGAAGCAGG - Intronic
1184504856 22:44894535-44894557 AAAGGCAAGCTGAGGGCAGCGGG + Intronic
1184769792 22:46590301-46590323 ATTGGGAAGCTGGGGGAAGGTGG + Intronic
1185115142 22:48929700-48929722 AAAGGCAAGCAAGAGGGAGCTGG - Intergenic
1203244965 22_KI270733v1_random:58834-58856 AAAGGCAAACAGTGGGAAACTGG - Intergenic
949109279 3:239095-239117 ACTGTCAAGTAGGGGGAACCCGG + Intronic
949993162 3:9596161-9596183 AATGGGAAACAGAGGGAAACAGG - Intergenic
950127023 3:10516064-10516086 ATTGGCAAGCACTGGAAAGCAGG + Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950686142 3:14619884-14619906 AATGGCAAGGAGGAGGCTGCAGG - Intergenic
953758377 3:45666881-45666903 AAGGGAAGGCAGGGAGAAGCTGG - Intronic
954289407 3:49641887-49641909 AATGGCCTGAAGTGGGAAGCAGG + Intronic
954393357 3:50279130-50279152 CATGGCAAGCAGTGGGCAGTCGG - Exonic
955379323 3:58424083-58424105 AATGCAAAGCAGGGGGCAGAGGG - Intronic
955649007 3:61172901-61172923 AATGGCCAGCAGGGGCAGGCAGG + Intronic
956742914 3:72289053-72289075 ATTAGCAAGCAGGGGCGAGCAGG - Intergenic
960732641 3:120743414-120743436 GAAGTGAAGCAGGGGGAAGCTGG + Intronic
960902515 3:122566334-122566356 CAGGGCAAGCAAGGGGAAGATGG + Intronic
961102747 3:124215352-124215374 ACTGGTATGCAGTGGGAAGCTGG + Intronic
961440847 3:126952399-126952421 CATGGCAGGCAGGGGACAGCAGG + Intronic
961537089 3:127576855-127576877 GATGGCCAGCAGGAAGAAGCGGG + Exonic
962512585 3:136116559-136116581 AATGGAAAGCAGAAAGAAGCAGG + Intronic
962851407 3:139310953-139310975 CATGGCCAGTAGTGGGAAGCAGG + Intronic
963233824 3:142936179-142936201 ACTGGCAAGGAGGTGGTAGCAGG + Intergenic
964017353 3:151963815-151963837 ACTGGCAGGCTGGGGGAAGTGGG + Intergenic
965179476 3:165383574-165383596 AAGTGAAAGCAGGGGGAAGCAGG + Intergenic
967014569 3:185470042-185470064 AAGGACAAGGAGGGGGAACCTGG + Intronic
968181910 3:196601681-196601703 AAGGGAAAGGAGGAGGAAGCTGG - Intergenic
968696351 4:2031165-2031187 AATGGAAAGCAGGAAAAAGCAGG - Intronic
968862218 4:3181755-3181777 ACTGGCAAGCAGGTGGTGGCAGG + Intronic
969108559 4:4827048-4827070 AATGGCATGCAAGGGTTAGCAGG + Intergenic
969259060 4:6022220-6022242 AAAGGCAACCAGGGAGGAGCTGG - Intergenic
969333449 4:6493164-6493186 AATTGCAGGTAGGGGGAACCTGG - Intronic
970046060 4:11855776-11855798 AATGGATAGAAGGGGGAAGTTGG - Intergenic
970049753 4:11900388-11900410 AATGGGAAGAAGGGGAAAGAGGG - Intergenic
974126783 4:57706672-57706694 AATGGAAGGAAGGGGGCAGCTGG + Intergenic
976361039 4:84178315-84178337 GATGGCCAGCAAGGGAAAGCTGG + Intergenic
979541617 4:121890173-121890195 AATGGGAAGTAGGGAGAAGTTGG + Intronic
980732975 4:136846718-136846740 AATGGAAAGCAAAGAGAAGCAGG - Intergenic
980998825 4:139808567-139808589 AAAGGCAAAAAGGAGGAAGCAGG + Intronic
981839848 4:149098686-149098708 AATGGCAGGTAGTGGGAACCAGG - Intergenic
983872083 4:172834406-172834428 ATGGGCAATCAGGGAGAAGCTGG + Intronic
984888055 4:184468548-184468570 TATGGCAAGCAAGGGCAAGTGGG + Intronic
985059185 4:186058945-186058967 TATGGCAAGCTGGGTGGAGCTGG - Intergenic
985649110 5:1099132-1099154 TCTGCCAAGCAGGGTGAAGCGGG + Intronic
986015494 5:3753786-3753808 AATTGTAAGCATTGGGAAGCAGG - Intergenic
986223719 5:5793735-5793757 ACAGGCTAGCAGGGGGAACCCGG - Intergenic
987011455 5:13770329-13770351 AAGGGCAAGAAGAGGGAAGAGGG + Intronic
990195345 5:53308981-53309003 AATGGAAAGCAAAGGAAAGCAGG - Intergenic
990537013 5:56733002-56733024 TATTCCAGGCAGGGGGAAGCTGG - Intergenic
990864812 5:60368817-60368839 AGTGGAAGGCAAGGGGAAGCAGG - Intronic
992582885 5:78200222-78200244 ACTGCCAAGCAGGGGGAGGGGGG + Intronic
992633677 5:78706593-78706615 AGTAGCAAGGAGTGGGAAGCAGG - Intronic
992655742 5:78907947-78907969 AATTAAAAGCAGGGGGAAGGGGG + Intronic
992969886 5:82045581-82045603 AATGCCAAGCTATGGGAAGCAGG + Intronic
993047832 5:82888641-82888663 AATGGGATGCTGAGGGAAGCAGG - Intergenic
993807178 5:92425348-92425370 AATGTCAAGCATGGAGAACCAGG - Intergenic
994327139 5:98461583-98461605 AAGGGCAAGGAGGGGAAAGGTGG + Intergenic
995090129 5:108164780-108164802 AATGACAAGCAGGTAGAAGGTGG + Intronic
996791937 5:127302791-127302813 AAAGGAAAGGAGGAGGAAGCAGG + Intronic
997624095 5:135319990-135320012 AAACGCAAGGAGGGGGAAGATGG - Intronic
1000350589 5:160349619-160349641 AAGGGCAAGAAGGGGGAGCCAGG - Exonic
1000737736 5:164926804-164926826 AAAGGCAAACAGTGGCAAGCTGG - Intergenic
1000745537 5:165028039-165028061 AATGGAAAGCAGTTGGAAGCTGG + Intergenic
1001338145 5:170818224-170818246 AATGGGTAGGAGGGGGCAGCTGG + Intergenic
1001780106 5:174360982-174361004 AATGGCGGGGAGGGGGAAGGTGG + Intergenic
1002440444 5:179261820-179261842 AGTGGCAGGCAAGGGGAAGCTGG + Intronic
1002676812 5:180923009-180923031 AATGGAAAGCAGGAAAAAGCAGG - Intronic
1002908225 6:1468210-1468232 AAAGGCAAAGAGGGGGAAGTAGG + Intergenic
1003016755 6:2474121-2474143 AAGGGCAGGCAGGGAGGAGCTGG + Intergenic
1003461015 6:6328272-6328294 ACTGGCAACCATGTGGAAGCTGG - Intergenic
1004000516 6:11592931-11592953 AGTGGGAAGCAGTGGGAGGCAGG + Intergenic
1004136085 6:12968178-12968200 AATGGAATGTGGGGGGAAGCGGG - Intronic
1005885915 6:30097590-30097612 AATGGGAAGCAGGTGGGGGCAGG + Intergenic
1006396950 6:33793723-33793745 AAGGGCATGCGGGGGGCAGCGGG - Intergenic
1006470024 6:34223523-34223545 AATAACAAGCATAGGGAAGCAGG + Intergenic
1006602515 6:35235434-35235456 AATGTCAAACAGGGGAAAGGCGG + Intronic
1007180369 6:39925338-39925360 AATGGGAAGGAGGGGAAAGGTGG + Intronic
1009706928 6:67264421-67264443 AATGGAAAGCAGAAAGAAGCAGG - Intergenic
1011476802 6:87756289-87756311 AATGCTGAGCAGGGAGAAGCAGG + Intergenic
1015124625 6:129739657-129739679 AATGGCAAGAATGAGGAAGGGGG - Intergenic
1017469083 6:154721913-154721935 AAGGCCAAGCAAGTGGAAGCAGG - Intergenic
1018027889 6:159819838-159819860 AACAGCAAGGAGGGGGATGCAGG + Intronic
1021266046 7:18523907-18523929 AATGGGAAGCAGGGCGGAGCGGG - Intronic
1021359782 7:19697398-19697420 AATGACAAGCTGGTTGAAGCTGG - Exonic
1022797280 7:33742180-33742202 TATGGCAAACATGGGGAAGGTGG + Intergenic
1023473139 7:40546877-40546899 AATGGCATGCAGAGCGGAGCTGG - Intronic
1027278990 7:76591750-76591772 AATGACAAGCAGCGGGGACCAGG - Intergenic
1027855614 7:83507552-83507574 AGCAGCAAGCAGGGGCAAGCAGG + Intronic
1028361167 7:89968353-89968375 AATGGAGGGCAGGGGAAAGCAGG - Intergenic
1029230353 7:99062469-99062491 AATAGTAAGCAAGGGGAAGGTGG + Intronic
1029676646 7:102074427-102074449 AAGGGGAAGCAGGTGGGAGCTGG - Intronic
1030029989 7:105360204-105360226 AATGGAAAGCAGAGAAAAGCAGG - Intronic
1030555545 7:111019850-111019872 TATGGAAAGCAGAGGGAAGGAGG - Intronic
1035751237 8:1997848-1997870 AAGGGCACGCAGGGGGACGGCGG + Intronic
1036540181 8:9700076-9700098 AGAGGCAAGCAGAGGGAAACGGG - Intronic
1036943359 8:13071793-13071815 CATTCCAAGCAGGGGCAAGCTGG - Intergenic
1037165138 8:15817973-15817995 AATGGAAAAAAGGAGGAAGCTGG + Intergenic
1038349890 8:26766369-26766391 TATGGCACGCTGGGGGAAGATGG - Intronic
1039110956 8:34040453-34040475 AATGTCAAGCAGTAGGAAGGTGG - Intergenic
1040404191 8:47084277-47084299 AATGGAAAACAGGAGAAAGCAGG - Intergenic
1041468268 8:58179915-58179937 AATGGCAAGGTGGGGAAAGGGGG + Intronic
1041549758 8:59087222-59087244 CATGGCACCCAGGGAGAAGCTGG + Intronic
1044319245 8:90784130-90784152 AATGGAAACCAGGGTGAAACTGG + Intronic
1045034612 8:98167546-98167568 AGTGGCAGGCAAGGGGAAGCTGG + Intergenic
1048348010 8:133592555-133592577 AATGGCAGGCCTGGGGAAGTTGG - Intergenic
1049058333 8:140256546-140256568 AATGGCAACCAAGCGGAAGCAGG - Intronic
1049219895 8:141424391-141424413 GATGGCAGCCAGGAGGAAGCTGG - Intronic
1049410962 8:142473848-142473870 AATGGCCAGCAGGGGGTGCCAGG - Intronic
1051372921 9:16373503-16373525 AATGGCAAGGATGGGGATGGTGG - Intergenic
1051806376 9:20997178-20997200 GATGGGAAGGAGAGGGAAGCTGG - Intergenic
1053398266 9:37795286-37795308 AATGGAAGTCAGGGAGAAGCAGG - Intronic
1055066068 9:72120067-72120089 ACTGGCAAGGAGAGAGAAGCAGG - Intronic
1055771098 9:79717847-79717869 AGTGGCAGGCAGGAGGCAGCTGG - Intronic
1056635800 9:88330293-88330315 AGGAGCAAGCAAGGGGAAGCAGG + Intergenic
1057788290 9:98105003-98105025 AATGGCAGGCAGGAAGAGGCAGG + Intronic
1058907492 9:109493785-109493807 AAAGGCAGCCAGGGGGAGGCCGG + Intronic
1059367427 9:113797328-113797350 AATGGGATGCGGTGGGAAGCAGG - Intergenic
1061866256 9:133493169-133493191 AATGGCAGCCAGGTGGATGCAGG + Intergenic
1203461299 Un_GL000220v1:41913-41935 AAAGGCAAACAGTGGGAAACTGG - Intergenic
1186696075 X:12033614-12033636 AATGGCAAGCAGGTGGGAAGAGG + Intergenic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1188173025 X:26951455-26951477 AAAGGCAAGCAAGGAGAACCAGG + Intergenic
1188640387 X:32494385-32494407 AATAGCAAAAAGGGGGAGGCAGG + Intronic
1190236072 X:48616758-48616780 AAAGGGAAGGAGGAGGAAGCAGG + Intergenic
1190735107 X:53250788-53250810 AATGGTAAGCAGGGGAAGGTGGG + Exonic
1191792496 X:64985777-64985799 TATGGCAAGCAGAGGCATGCTGG + Intronic
1192170514 X:68851754-68851776 AATGGAAAGGAAGGGAAAGCGGG - Intergenic
1192966306 X:76181107-76181129 AATGGAAAGCAGAAGAAAGCAGG - Intergenic
1192974128 X:76265572-76265594 AATGGAAAGCAGAAGAAAGCAGG - Intergenic
1195561287 X:106287239-106287261 AATGGGAACAAGGGAGAAGCTGG + Intergenic
1198264643 X:134998114-134998136 AAGGGTAAGCAGGGGGAAAATGG - Intergenic
1199997075 X:153032178-153032200 AAGGGCAGGCAGGGGACAGCAGG + Intergenic