ID: 1079798931

View in Genome Browser
Species Human (GRCh38)
Location 11:24844761-24844783
Sequence CCAACATAGAACTCGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 17, 2: 82, 3: 177, 4: 431}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079798927_1079798931 -3 Left 1079798927 11:24844741-24844763 CCAGTCATGGCTGAAAGAGGCCA 0: 1
1: 47
2: 424
3: 913
4: 1348
Right 1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG 0: 1
1: 17
2: 82
3: 177
4: 431
1079798920_1079798931 30 Left 1079798920 11:24844708-24844730 CCAAGGGACTTAGTGTCCTGTGT 0: 1
1: 60
2: 394
3: 604
4: 1015
Right 1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG 0: 1
1: 17
2: 82
3: 177
4: 431
1079798923_1079798931 7 Left 1079798923 11:24844731-24844753 CCCAGCCACTCCAGTCATGGCTG 0: 8
1: 156
2: 266
3: 616
4: 974
Right 1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG 0: 1
1: 17
2: 82
3: 177
4: 431
1079798925_1079798931 2 Left 1079798925 11:24844736-24844758 CCACTCCAGTCATGGCTGAAAGA 0: 2
1: 22
2: 239
3: 323
4: 608
Right 1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG 0: 1
1: 17
2: 82
3: 177
4: 431
1079798924_1079798931 6 Left 1079798924 11:24844732-24844754 CCAGCCACTCCAGTCATGGCTGA 0: 8
1: 157
2: 273
3: 596
4: 937
Right 1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG 0: 1
1: 17
2: 82
3: 177
4: 431
1079798921_1079798931 14 Left 1079798921 11:24844724-24844746 CCTGTGTCCCAGCCACTCCAGTC 0: 10
1: 141
2: 356
3: 711
4: 1330
Right 1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG 0: 1
1: 17
2: 82
3: 177
4: 431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079798931 Original CRISPR CCAACATAGAACTCGGGCCA TGG Intronic
902115317 1:14116387-14116409 CCAACATAGAGCTTGGGTCTTGG + Intergenic
902271232 1:15306645-15306667 CCAACATAGAGCTTGGGCTGTGG + Intronic
906463769 1:46058111-46058133 CCAACATAGGGCTCAGGCCATGG + Intronic
907007793 1:50932949-50932971 CCAACATAGAGCTTGGGCTATGG - Intronic
907439234 1:54468627-54468649 CCAATGTAGAGCTAGGGCCATGG + Intergenic
907925653 1:58953198-58953220 CCAACATAGAGCTTGGGCTGTGG + Intergenic
908006907 1:59737034-59737056 CCAACATAGAGCTCAGGCCATGG + Intronic
908047358 1:60184944-60184966 CCAACATAGAGCTCAGGCCATGG - Intergenic
908919258 1:69170156-69170178 CCAAGGTAGAGCTCAGGCCATGG + Intergenic
908967866 1:69787617-69787639 CCAACATAGAGCTCAGGCCATGG - Intronic
909065586 1:70931650-70931672 CCAACATACAGCTTGGCCCATGG - Intronic
909104507 1:71391925-71391947 CCAACATTGAGCTCAGGCCGTGG + Intergenic
909185384 1:72480175-72480197 CCAACATAGAGCTCAGGCTGTGG - Intergenic
909192584 1:72572974-72572996 CCAATGTAGAGCTTGGGCCATGG + Intergenic
909200758 1:72687690-72687712 CCAACATAGAGCTCAGGCTATGG - Intergenic
909250227 1:73344202-73344224 CCAACTTAGAGCTTGGGCCATGG + Intergenic
909293341 1:73912459-73912481 CCAAGGTACAACTCAGGCCATGG - Intergenic
909457760 1:75869616-75869638 CCAACACACAGCTCGGGCCATGG + Intronic
909808826 1:79905852-79905874 CCAACACAGAACTTGGGCCATGG - Intergenic
910256142 1:85249127-85249149 CCAACGTAGAGCTCAGGCCATGG - Intergenic
911500582 1:98680205-98680227 CCAACATAGAGCTCAGGTCATGG - Intronic
911530384 1:99036870-99036892 CCAATGTAGAGCTCGGGCCGTGG - Intergenic
911541592 1:99163994-99164016 CCAACGTAGAGCTGGGGCCATGG + Intergenic
911686287 1:100780832-100780854 CCAACATAGAGCTCAGGCTGTGG - Intergenic
912121682 1:106479437-106479459 CCAAAATAGAGATTGGGCCATGG + Intergenic
912165659 1:107039792-107039814 CCAATGTAGAGCTTGGGCCATGG + Intergenic
912579158 1:110704675-110704697 CTAACATAGAGTTCAGGCCATGG - Intergenic
912890420 1:113524020-113524042 CCAAGGTACAGCTCGGGCCATGG + Intronic
913336917 1:117717156-117717178 CCAAAGTAGAGCTCAGGCCATGG + Intergenic
916318749 1:163479589-163479611 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
916467196 1:165084305-165084327 CCAATATAGAGCTTGGGCCATGG + Intergenic
917022245 1:170601960-170601982 CCAACATAGAGCTCTGGCTGTGG - Intergenic
917082629 1:171272149-171272171 CCAACATAGAGCTCAGGCAGTGG + Intronic
917290830 1:173470913-173470935 CCAATATACAGCTTGGGCCATGG + Intergenic
917547304 1:175984299-175984321 CCAACAGAGAACTCGAGCCATGG + Intronic
917681834 1:177375494-177375516 CCAACATAGAACTTAGGCCATGG - Intergenic
917892427 1:179452993-179453015 CCAACATAGAGCTCAGGCTGTGG + Intronic
917894933 1:179478479-179478501 CCAAGATACAGCTGGGGCCATGG - Intronic
918079475 1:181194784-181194806 CCTACATAGAGCTTGGGCCATGG + Intergenic
918718156 1:187818228-187818250 CCAACATAGAGCTTGGGCCATGG - Intergenic
918734180 1:188037852-188037874 CCAACATAGAACTCAGGCTGTGG + Intergenic
918886592 1:190201711-190201733 CCAACATAGAATTCGGAACGTGG + Intronic
919175147 1:194010356-194010378 CCAATGTAGAGCTCGGGTCATGG + Intergenic
919209098 1:194455992-194456014 CCAACATACAGCTTGGGCTATGG - Intergenic
919221802 1:194639506-194639528 CTAACATAGAGCTTGGGACATGG + Intergenic
919222102 1:194642593-194642615 CCAACATAGAGCTTGGGCCATGG + Intergenic
919242711 1:194935788-194935810 CCAGCATAGAGCTTGGGCCATGG + Intergenic
920597922 1:207291746-207291768 CCAACACAGAGCTCAGGCCATGG + Intergenic
920895984 1:210049789-210049811 CCACCACAGAGCTCGGGCCGTGG - Intronic
921386684 1:214577103-214577125 TCAACATAGAACTCAGGCTGTGG + Intergenic
921496897 1:215853261-215853283 CCAATGTAGAGCTTGGGCCACGG - Intronic
921716007 1:218417795-218417817 CCAACATAGAGCTTGGGCCATGG + Intronic
921773544 1:219071496-219071518 CCAACATAGAGCTTGGGCTATGG + Intergenic
922164083 1:223100544-223100566 CCAATGTAGAGCTCGGGCCGTGG + Intergenic
923198008 1:231686463-231686485 CCAACATAGAGCTCGGGCCGTGG - Intronic
923687360 1:236162647-236162669 CCAACGTAGAGCTCGGGCTGTGG + Intronic
1066040780 10:31546382-31546404 CCAATGTAGAGCTAGGGCCATGG - Intergenic
1066462288 10:35622591-35622613 CCAACAGAGAACACAGGTCACGG + Intergenic
1066479975 10:35786265-35786287 CCAGCATAGAGCTCGGGCCACGG - Intergenic
1067812317 10:49439367-49439389 CCAACATAGAGCTCAGGCCATGG - Intergenic
1067956270 10:50795008-50795030 CCAACATACAACTCGGGCTCTGG + Intronic
1068229852 10:54157410-54157432 CCAACATAGAGCTCAGGCTGTGG - Intronic
1069173621 10:65262857-65262879 CCAACATAGAGTTCGGGCTGTGG - Intergenic
1069175759 10:65286502-65286524 CCAACATAGAGCTCGGGCTGTGG - Intergenic
1069211050 10:65760605-65760627 CCAACATAGAGCTCGGGCTGTGG - Intergenic
1069367857 10:67712550-67712572 CCAATATAGAGGTCCGGCCATGG + Intergenic
1069803882 10:71105119-71105141 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1069805183 10:71117898-71117920 CCAACGTAGAGCTTGGGCCGTGG + Intergenic
1071098925 10:82012237-82012259 CCAAGGTACAACTCAGGCCATGG - Intronic
1071981038 10:91004498-91004520 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1072488033 10:95874870-95874892 CCAACATAGAGCTTGGGCTGTGG - Exonic
1072946992 10:99819289-99819311 ACAAGATAGAACTTGGGCCATGG + Intronic
1072963389 10:99951107-99951129 CCAATGTAGAACTCAGGCCATGG + Intronic
1073387030 10:103134382-103134404 CCAATATAGAGCTCGGGCTGTGG + Intronic
1074262718 10:111870321-111870343 CCAATGTAGAGCTCGGGCTATGG + Intergenic
1074965825 10:118490042-118490064 CCAAAATAGAGCTCAGGCCATGG + Intergenic
1075339684 10:121636450-121636472 TCAACATAGTACTCAGCCCATGG - Intergenic
1075543684 10:123337405-123337427 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1076225679 10:128773137-128773159 CCAACATAGAGCTTGGGTCATGG + Intergenic
1076464844 10:130671986-130672008 CCAACATAGAGCTCAGGCTCTGG - Intergenic
1076760095 10:132599866-132599888 CCAACATACAGCTCGGGCTGTGG - Intronic
1078117373 11:8466946-8466968 CCAACATAGAGCTCGGGCCATGG - Intronic
1078496734 11:11824992-11825014 CCAACATAGAGCTTGGGCCATGG - Intergenic
1079143832 11:17833236-17833258 CCAACGTAGAGCTTGGGCCGTGG + Intronic
1079181964 11:18201639-18201661 CCAACATAGAGCTTGAGCCATGG - Intronic
1079341059 11:19612112-19612134 CCAATGTAGAGCTTGGGCCATGG - Intronic
1079500267 11:21094692-21094714 CCAACATAGAGTTCAGGCCATGG - Intronic
1079739187 11:24036264-24036286 CCAATATAGAGCTTGGACCATGG + Intergenic
1079798931 11:24844761-24844783 CCAACATAGAACTCGGGCCATGG + Intronic
1079880584 11:25922034-25922056 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1080204912 11:29717308-29717330 CCAACATAGAGCTCAGGTCATGG - Intergenic
1080215182 11:29832060-29832082 CCAAGATACAACTTGGGCCATGG + Intergenic
1080715663 11:34797555-34797577 CCAAGATACAGCTCAGGCCATGG + Intergenic
1080717604 11:34819034-34819056 CCAACATAGAGCTCAGACCATGG - Intergenic
1080817427 11:35772073-35772095 CCAACGTAGAGCTCGGGCCTTGG + Intronic
1081008158 11:37774119-37774141 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1081077694 11:38696631-38696653 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1081083855 11:38775142-38775164 CCAACATAGAGCTCAGGCCATGG - Intergenic
1082044245 11:47712028-47712050 GCAACATTGCACTCCGGCCAAGG + Intronic
1083121888 11:60521050-60521072 CCAATGTAGAGCTTGGGCCATGG - Intronic
1083248743 11:61450991-61451013 CCCACATAGAACTCATTCCAGGG + Intronic
1084496604 11:69508535-69508557 CAAACATAGACCTTGGGCAATGG - Intergenic
1084880712 11:72169644-72169666 CCAACATAGAGCTTAGGCCATGG + Intergenic
1085236482 11:75019461-75019483 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1085866745 11:80303589-80303611 CCAACGTAGAGCTTGAGCCATGG + Intergenic
1086176752 11:83900532-83900554 CCAACATAGAGCTTGGGCTGTGG + Intronic
1086519253 11:87651113-87651135 CCAATGTACAGCTCGGGCCATGG - Intergenic
1086580374 11:88391953-88391975 CCAATGTAGAGCTCGGACCATGG - Intergenic
1086764316 11:90675772-90675794 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1086826756 11:91507986-91508008 CCAACATAGAGCTCAGGTCATGG - Intergenic
1086933836 11:92722808-92722830 CCAACATAGAGCTCAGGCCATGG - Intronic
1086969551 11:93065920-93065942 CCAACACAGAGCTCCGGCCATGG - Intergenic
1087126029 11:94626444-94626466 CCAACGTAGAGCTCAGGCCATGG - Intergenic
1087255571 11:95948799-95948821 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1087438302 11:98151039-98151061 CCAACATAGAGCTCAGACCATGG + Intergenic
1090431475 11:126650059-126650081 CCAATGTAGAGCTCAGGCCATGG - Intronic
1090727393 11:129540117-129540139 CCAACGTAGAGCTCGGGCTGTGG - Intergenic
1091244607 11:134081480-134081502 CCAGCATAGAGCTGAGGCCATGG + Intronic
1091350702 11:134891893-134891915 CCAAGGTACAACTCAGGCCATGG + Intergenic
1091382306 12:69832-69854 CAAACATACAAAACGGGCCACGG - Intronic
1091778463 12:3199659-3199681 CCAACCGAGAACGCGGGGCAAGG + Intronic
1091908748 12:4211727-4211749 CAAACAGAGAACGCGTGCCAAGG + Intergenic
1091932081 12:4404151-4404173 CCAACATAGAGCTTGGGCCATGG + Intergenic
1091982740 12:4879582-4879604 CCAATGTAGAATTCAGGCCATGG - Intergenic
1093300063 12:17442891-17442913 CCAACATAGAGCTTGGGTCATGG + Intergenic
1093353102 12:18128134-18128156 CCAACATAGAACTTGGGTTGTGG + Intronic
1093536671 12:20231011-20231033 CCAACATAGAGCTTGAGCCATGG - Intergenic
1094489269 12:30948549-30948571 CCAACATAAAGCTCGGGCTGTGG - Intronic
1095039691 12:37427387-37427409 CCAACATAGAACTCAGGCCATGG + Intergenic
1095252606 12:39996667-39996689 CCAACATAGAGTTCGGGCCGTGG + Intronic
1095511134 12:42952835-42952857 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1096441804 12:51649606-51649628 CCAATGTAGAGCTCGGGCCAAGG - Intronic
1096875563 12:54627588-54627610 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1097045903 12:56187940-56187962 GAAACATAGAAGTAGGGCCAGGG - Intronic
1097360497 12:58654179-58654201 CCAATGTAGAGCTCAGGCCATGG - Intronic
1097481021 12:60126187-60126209 CCAAGGTAGAGCTCAGGCCATGG + Intergenic
1097565630 12:61265254-61265276 CCAACATAGAGCTCGAGCCATGG + Intergenic
1098676338 12:73294304-73294326 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1099004091 12:77216483-77216505 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1099396500 12:82147025-82147047 CCAATGTAGAGCTCCGGCCATGG + Intergenic
1099501445 12:83418935-83418957 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1099525906 12:83719256-83719278 CCAACACAGAGCTCAGGCCATGG + Intergenic
1099722544 12:86382742-86382764 CAGACATAGAGCTTGGGCCATGG + Intronic
1099800556 12:87451678-87451700 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
1099846180 12:88031255-88031277 CCAACATAGAGCTCGAGCTGTGG - Intronic
1099858924 12:88204970-88204992 CCAAGGTACAGCTCGGGCCATGG + Intergenic
1101113248 12:101506705-101506727 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1101222781 12:102658150-102658172 CCAGCATAGAGCTTGGGCCGTGG - Intergenic
1101359008 12:104008818-104008840 CCAACATAGGGCTTGCGCCATGG + Intronic
1101692754 12:107096773-107096795 CCAACGTACAGCTCAGGCCATGG + Intergenic
1102528651 12:113530257-113530279 CCAACATAGAGCTCGGGCCGTGG + Intergenic
1102565478 12:113794704-113794726 CCTCCATGGAACTCTGGCCAAGG - Intergenic
1103588417 12:121973181-121973203 CCAACATAGAGCTCAGGCTGTGG + Intronic
1105609452 13:21955240-21955262 CCAACACAGAGCTCAGCCCATGG - Intergenic
1106048168 13:26165168-26165190 CCAACGTAGAACTTGGGACATGG + Intronic
1106496864 13:30286398-30286420 CCAAGGTACAACTCAGGCCATGG + Intronic
1106917337 13:34529641-34529663 CCAACATACAGCTCGGGCTGTGG + Intergenic
1107209592 13:37837001-37837023 CCAACATAGAGCTCAGGCCATGG + Intronic
1107554787 13:41508118-41508140 CCAATGTAGAACTCAGGCCGTGG - Intergenic
1107961925 13:45566542-45566564 CCAACATAGAGCTTGGGCCTTGG + Intronic
1108936803 13:55891573-55891595 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1109315060 13:60740443-60740465 CCAACATAAAGCTCAGGCTATGG - Intergenic
1109407337 13:61918947-61918969 CAAACATAGAGCTCAGGCCATGG - Intergenic
1109416840 13:62051595-62051617 CCAAGGTACAGCTCGGGCCATGG + Intergenic
1109480420 13:62945300-62945322 CCAATGTAGAGCTCAGGCCATGG - Intergenic
1109522495 13:63532029-63532051 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1109526305 13:63580540-63580562 CCAATATAGACCTCTGGCCATGG - Intergenic
1109702745 13:66048095-66048117 CCGATGTAGAGCTCGGGCCATGG - Intergenic
1110487891 13:76068140-76068162 CCAAGCTAAAGCTCGGGCCATGG + Intergenic
1111083485 13:83342902-83342924 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1111105748 13:83643007-83643029 CCAACATAGAGCTCAGGCCATGG - Intergenic
1111143818 13:84155848-84155870 CCAACATAGAGCTTGGGCCATGG + Intergenic
1111527627 13:89492573-89492595 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1111751356 13:92335296-92335318 CCAACATACTGCTTGGGCCATGG - Intronic
1112799338 13:103093084-103093106 CCAACGTAGAGCTCAGGACATGG - Intergenic
1112861267 13:103831451-103831473 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1113167013 13:107453432-107453454 CCAAGATACAACTCAGGCCATGG - Intronic
1113280512 13:108782767-108782789 CCAATGTAGAGCTTGGGCCATGG + Intronic
1114380498 14:22198573-22198595 CCAACATAGAGCTCAGGCCATGG + Intergenic
1114812515 14:25917273-25917295 CCAACATAGAGCTCAGGCCATGG + Intergenic
1114936756 14:27548627-27548649 CCAAGATACAGCTCAGGCCATGG + Intergenic
1114984520 14:28210283-28210305 CCAACATAGAGCTCAGGCCATGG + Intergenic
1114986116 14:28230836-28230858 CCAACATAGAGCTGGGGCCATGG - Intergenic
1115112379 14:29839799-29839821 CCAACATAGAGCTCAGGTCATGG - Intronic
1115541697 14:34427227-34427249 CAAACGTAGAGCTCAGGCCATGG + Intronic
1115820300 14:37206273-37206295 CCAATGTAGAGCTCAGGCCATGG + Intronic
1115822357 14:37225507-37225529 CCACCATAGAGCTCAGGCCATGG - Intronic
1115840303 14:37462247-37462269 CCAATGTAGAGCTCAGGCCATGG - Intronic
1115942206 14:38622166-38622188 CCAACCTAGAGCTCCAGCCATGG + Intergenic
1116024268 14:39496852-39496874 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1116275226 14:42824306-42824328 CCATCATAAAGCTCAGGCCATGG + Intergenic
1116281562 14:42914922-42914944 CCAATGTAGAGCTTGGGCCATGG - Intergenic
1116762084 14:49027010-49027032 TGAACGTAGAGCTCGGGCCATGG + Intergenic
1116917242 14:50537203-50537225 CCAACATAGAGCTGGGGCCGTGG + Intronic
1118494132 14:66291432-66291454 CCAACACAGAACTTATGCCATGG + Intergenic
1118598001 14:67451042-67451064 CCAACATAGAGCTCAGGCTGTGG + Intronic
1118835978 14:69478180-69478202 ACAACGTAGAGCTTGGGCCATGG - Intergenic
1119200543 14:72748743-72748765 CCAACATAGAGCTCAGGCTGTGG + Intronic
1124171376 15:27376621-27376643 CCAACATAAAGTTCGGGCCATGG - Intronic
1125279257 15:38026823-38026845 CCAACATAGAGCTCGGACTGTGG + Intergenic
1126126379 15:45298056-45298078 CCAACATAGAGCTCAGGCCGTGG + Intergenic
1126411466 15:48376883-48376905 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1130422048 15:83757391-83757413 CCAAGGTACAACTCAGGCCATGG - Intronic
1130738951 15:86577738-86577760 CCAACATAGAGCTCGGGCCATGG + Intronic
1131743660 15:95421487-95421509 CCAAAATAGAGCTCGGGCCATGG - Intergenic
1131980172 15:97987073-97987095 CCAACATACAGCTCTGGCTATGG + Intergenic
1132272977 15:100543260-100543282 CCAACAGAGAACCAGTGCCAGGG - Intronic
1133427895 16:5708953-5708975 GCAAGAGAGAACACGGGCCATGG + Intergenic
1138800125 16:60016783-60016805 CCAAGGTACAACTCTGGCCATGG - Intergenic
1138859991 16:60744383-60744405 CCAACGCAGAGCTTGGGCCATGG - Intergenic
1139113420 16:63919828-63919850 CCAATGTAGAGCTCAGGCCATGG - Intergenic
1139133851 16:64178255-64178277 CTAATGTAGAACTCAGGCCATGG + Intergenic
1141037828 16:80643703-80643725 CCAACATACAGCTTGGGCCATGG - Intronic
1143721210 17:8811188-8811210 CCAATGTAGAGCTCGGGCCATGG - Intronic
1145378181 17:22371062-22371084 CCAACATAGAACTCAGGCCATGG - Intergenic
1146385192 17:32364656-32364678 CCAACATAAAACGCAGGCTAGGG - Intronic
1147176344 17:38658459-38658481 CCAACACAGAACCCAGCCCAGGG + Intergenic
1148390546 17:47269050-47269072 CCAACATAGAGCTCAGGCCATGG - Intronic
1149145819 17:53491200-53491222 CCAAAATATAGCTCAGGCCATGG - Intergenic
1149308649 17:55373184-55373206 CCAACATAGAGCTCAGGCCATGG + Intergenic
1149341112 17:55687319-55687341 CCAATATAGAGCTTGGGCCATGG + Intergenic
1149366776 17:55953029-55953051 CCAACACAGAGCTTGGGCCATGG + Intergenic
1151135822 17:71945011-71945033 CCAACATAGAACTTGGGCCATGG + Intergenic
1151501001 17:74488824-74488846 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1151892660 17:76959812-76959834 ACAACAAAGAACGTGGGCCATGG + Intergenic
1151897950 17:76993068-76993090 CCAAGTTGGAACTGGGGCCAGGG + Intergenic
1152300800 17:79494464-79494486 CCAACAAAGCACTTGGGCCTGGG + Intronic
1153214835 18:2809867-2809889 ACAACATAGAGCTCGGGCTGTGG - Intergenic
1154049751 18:10942926-10942948 CCAACACAGAGCTTGGGCTATGG + Intronic
1155679646 18:28474050-28474072 CCAATGTAGAGCTCGGGCCATGG + Intergenic
1156081406 18:33340669-33340691 CCAACATAGAGCTCGGGTTGTGG + Intronic
1156153047 18:34266324-34266346 CCAATACACAGCTCGGGCCATGG + Intergenic
1156265918 18:35488470-35488492 CCAAGGTAGAGCTTGGGCCACGG - Intronic
1156817512 18:41328594-41328616 CCAACATAGAGCACGGACCATGG + Intergenic
1156858861 18:41813834-41813856 CCAACATAGAGCTCAGGTCGTGG - Intergenic
1157003104 18:43550502-43550524 CCAAGACAGAGCTCAGGCCACGG - Intergenic
1157408809 18:47446609-47446631 CCAATATAGAGCTCAGGCTATGG + Intergenic
1158222048 18:55160229-55160251 CCCACATAGAGCTCGGGCTGTGG + Intergenic
1159157345 18:64601509-64601531 AAAACATAGAGCTTGGGCCATGG - Intergenic
1159641189 18:70864729-70864751 CCAACATAGAGCTTTGGCCATGG + Intergenic
1159650411 18:70971285-70971307 CCAAGATACAGCTCAGGCCATGG - Intergenic
1159761316 18:72430139-72430161 TCAGCATAGAGCTCGGGCCGTGG - Intergenic
1160096439 18:75877803-75877825 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1162296297 19:9816035-9816057 CCAACGTATAACTCGGGCTGTGG - Intronic
1164494829 19:28750208-28750230 CCAACATAGAGCTCAGGCCATGG - Intergenic
1165703676 19:37958853-37958875 CCAATATAGAACATGGGCAAAGG + Intronic
1165888406 19:39095896-39095918 ACAACATAGAGCTTGGGCCGTGG - Intronic
1165974790 19:39666192-39666214 CCAACATAGAACTCAGGCCATGG - Intergenic
925257115 2:2499667-2499689 CCAAGGTAGAACTCGAGCCTTGG - Intergenic
927090716 2:19708926-19708948 CCTACAGAGCACTCTGGCCATGG - Intergenic
927288287 2:21379277-21379299 CCAACATAGAGCTCAGGCTGTGG - Intergenic
927360182 2:22223789-22223811 CCAACATAGAGCTCAGGCCATGG + Intergenic
928594257 2:32845484-32845506 CCAACATAGAGCTCAGCCCATGG + Intergenic
928804366 2:35132661-35132683 CCAAGGTACAGCTCGGGCCATGG - Intergenic
930006763 2:46904034-46904056 CCAACATACAGCTCGGGCTGTGG + Exonic
930076140 2:47407182-47407204 CCAACCTAGAGCTCAGGCCATGG + Intronic
930293961 2:49530302-49530324 CCAAGATAGAGCTAGGGCCATGG - Intergenic
930782540 2:55237105-55237127 CCAACATACATCTCAGGCAAAGG + Intronic
932960628 2:76408788-76408810 CCAACATAGAGCTCAGGCCATGG + Intergenic
933008264 2:77023160-77023182 CCAACATAGAGCTTGGGCTGTGG - Intronic
933064193 2:77773169-77773191 CCAATGTAGAGCTCAGGCCATGG - Intergenic
933065018 2:77781700-77781722 CCAACATAGAGCTCGGGCCATGG + Intergenic
933085095 2:78046013-78046035 CCAAGGTACAGCTCGGGCCATGG + Intergenic
933418785 2:82022449-82022471 CCAACACAGGGCTTGGGCCATGG - Intergenic
934636388 2:95992743-95992765 CCATCATAGGACTTGGGCGACGG - Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935419757 2:102854726-102854748 CCAACATAGATCTCAGGCCATGG - Intergenic
935948943 2:108311759-108311781 CCAACGTAGAGCTCAGGCCATGG + Intergenic
936800312 2:116258014-116258036 CCAAGATACAGCTCAGGCCATGG - Intergenic
936827780 2:116602812-116602834 CCAACATAGAGCTTGGGCCATGG + Intergenic
936831842 2:116656133-116656155 CCAACATAGAGCTCAGGCTGTGG - Intergenic
937762517 2:125622832-125622854 CCAACATAGAGCTCAAGCCATGG + Intergenic
938878367 2:135557697-135557719 TCAACATTGAACTGTGGCCAGGG + Intronic
939752441 2:146064160-146064182 CAAACATAGAGCTTGGGCCGTGG - Intergenic
940542999 2:155045936-155045958 CTAACATAGAGCTCAGGCCATGG - Intergenic
941137248 2:161733347-161733369 CCAACATAGCTCTCAGGCCATGG + Intronic
941570278 2:167161539-167161561 CCAACATAGAGCCTGGGCCATGG - Intronic
942727511 2:179026353-179026375 CCAACATAGAGCTCAGGCCATGG + Intronic
943219822 2:185090473-185090495 CCAATTTAGAGCTTGGGCCATGG + Intergenic
943238017 2:185347645-185347667 CCAGCAGACAGCTCGGGCCATGG + Intergenic
943386690 2:187210514-187210536 CCAATGTAGAGCTCAGGCCATGG + Intergenic
943417778 2:187630362-187630384 CCAATGTAGAGCTTGGGCCATGG + Intergenic
943511237 2:188830263-188830285 CCAACAGAGAACTCGGGCCACGG + Intergenic
943832877 2:192485175-192485197 TCAACATAGAGCTCAGGCCATGG + Intergenic
944101371 2:196031218-196031240 CCAACGTGGAGCTTGGGCCATGG - Intronic
944828014 2:203504401-203504423 CCAACATAGAGCTCAGGCTGTGG - Intronic
945089766 2:206168046-206168068 CCAGCGTAGAGCTTGGGCCATGG - Intergenic
945089911 2:206169018-206169040 CCAATGTAGAGCTCGGGCCATGG + Intergenic
945324931 2:208471454-208471476 CCAATGTAGAGCTTGGGCCATGG + Intronic
945618680 2:212106816-212106838 CCAAGGTAGAGCTCAGGCCATGG + Intronic
945709470 2:213278059-213278081 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
945760071 2:213903451-213903473 CCAACGTAGAGCTTGGGCCATGG - Intronic
946108264 2:217391074-217391096 CCAATGTACAGCTCGGGCCATGG - Intronic
946562501 2:220928386-220928408 CCAACATAGAGCTTGCGCCATGG - Intergenic
946844877 2:223850403-223850425 CCAAGATACAGCTCAGGCCATGG + Intergenic
947008460 2:225538471-225538493 CCAACATAGAGCTCAGTCCATGG - Intronic
947296443 2:228635801-228635823 CCAACGTAGAGCTCGAGCCATGG - Intergenic
947345613 2:229186535-229186557 CCAACATAGAGCTTGGGCTGTGG - Intronic
948346532 2:237303535-237303557 CCAACATAGAGCTTGGGCCATGG + Intergenic
948580606 2:238985445-238985467 CCACCATAGAGCTGGGGCCCAGG + Intergenic
1169676360 20:8159289-8159311 CCAATATAGAACATGGGCCATGG - Intronic
1170310058 20:14982586-14982608 CCAACGCAGAGCTTGGGCCATGG + Intronic
1170475000 20:16706026-16706048 CCAACATAGAGCGTGGGCCATGG + Intergenic
1171130127 20:22644663-22644685 CCAATGTAGAGCTTGGGCCAAGG - Intergenic
1171525095 20:25802944-25802966 CCAACATAGAACTCAGGCCATGG + Intronic
1171534279 20:25872605-25872627 ACAACATAGAACTCAGGCCATGG + Intergenic
1171551732 20:26052940-26052962 CCAACATAGAACTCAGGCCATGG - Intergenic
1171571472 20:26255494-26255516 CCAACATAGAACTCAGGCCTTGG + Intergenic
1171792853 20:29544243-29544265 ACAACATAGAACTCAGGCCACGG - Intergenic
1171855609 20:30340161-30340183 ACAACATAGAACCCAGGCCATGG + Intergenic
1172759049 20:37309194-37309216 CCAACACAGAACAAGGGCCTAGG - Intronic
1173711029 20:45155879-45155901 CCAAGATACAGCTCAGGCCATGG + Intergenic
1174111779 20:48202261-48202283 CCAGCAGAGAGCCCGGGCCAGGG - Intergenic
1174169358 20:48606564-48606586 CCAGCAGAGAGCCCGGGCCAGGG + Intergenic
1175507183 20:59494293-59494315 CCAACACAGGACTCGGACAAAGG - Intergenic
1176256116 20:64154135-64154157 ACAACAGGGAACACGGGCCATGG - Intronic
1176282893 20:64325001-64325023 CAAACATACAAAACGGGCCACGG + Intergenic
1176695976 21:9978431-9978453 ACAACATAGAGCTCAGGCTATGG + Intergenic
1177118168 21:17110166-17110188 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1177266998 21:18798394-18798416 CCAACCTAGAGCTCAGGCCATGG + Intergenic
1177288160 21:19077811-19077833 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1177339788 21:19784012-19784034 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1177479626 21:21669693-21669715 CCAAGGTAGAGCTCGGGCCATGG - Intergenic
1177592310 21:23186026-23186048 CCAGCATAGCACTGGGCCCATGG - Intergenic
1177952202 21:27552381-27552403 CCAAGGTACAACTCAGGCCATGG - Intergenic
1179332057 21:40412964-40412986 CCAACATAGAGCTCAGGCTGTGG + Intronic
1179678204 21:42999193-42999215 CCAATGCAGAACTCGGGCCTTGG - Intronic
1180573650 22:16752498-16752520 CCAATATAGAACTCAGGCCATGG + Intergenic
1180968663 22:19803529-19803551 CCAACATGGAACTCCTCCCAGGG - Intronic
1185239671 22:49735791-49735813 CCAACCTGGAGCTCCGGCCAGGG + Intergenic
949665305 3:6331895-6331917 CCAACATAGAGCTCAGGCCGTGG + Intergenic
950179049 3:10898034-10898056 CCAATGTAGAGCTCCGGCCATGG - Intronic
950800730 3:15550172-15550194 CCAACATACAGCTCGGGCTGTGG + Intergenic
951093097 3:18598090-18598112 CCAATGTAGAGCTTGGGCCATGG - Intergenic
951324562 3:21286455-21286477 CCAAGATACAGCTCGGGCCATGG + Intergenic
952185247 3:30961277-30961299 CCAACATAGAGCTCGGGCCATGG - Intergenic
953503749 3:43462865-43462887 CCAATGTAGAGCTCAGGCCATGG + Intronic
955435495 3:58894947-58894969 CCAACATAGAGCTTAGGCCATGG - Intronic
956169559 3:66421987-66422009 GCAACATAGAGCACGGACCATGG - Intronic
956348879 3:68312070-68312092 TCAACGTAGAACTCAGGTCATGG - Intronic
956363199 3:68471056-68471078 CCAACGTACAGCTCAGGCCATGG + Intronic
956474945 3:69609958-69609980 CCAATGTAGAGCTTGGGCCATGG + Intergenic
956503245 3:69910150-69910172 CCAACATAGAGCTTGGGCTATGG + Intronic
956546388 3:70408055-70408077 CCAACCTAGAGCTTGGGCCGTGG - Intergenic
956558816 3:70551175-70551197 CCAACATAGAGCTCGGGACATGG - Intergenic
956714194 3:72063759-72063781 CCAACGTAGAGCTCAGGCCATGG - Intergenic
956938606 3:74131983-74132005 CCAATATAGAGCTCAGGCTATGG - Intergenic
957300616 3:78387840-78387862 CCAACATTGAGCTCAGGCCGTGG - Intergenic
957703986 3:83755925-83755947 CCAACGTAGAGCTTGGGCCTTGG + Intergenic
957933564 3:86913461-86913483 CCTACAGAGAACTCTGGCAATGG + Intergenic
959054442 3:101553676-101553698 CAAACAAAGAGCTTGGGCCATGG + Intergenic
959104595 3:102051634-102051656 CCAACATAGAGCTCAGGCCGTGG + Intergenic
959233654 3:103690623-103690645 CCAATGTAGAGCTCAGGCCATGG - Intergenic
959317022 3:104821879-104821901 CCAACATAGAGCTCAGGCCATGG + Intergenic
959624322 3:108432696-108432718 TCAACATAGAGCTTGGGTCATGG + Intronic
959730027 3:109590714-109590736 CCAACATAGAGCTCAGGCTATGG - Intergenic
959754743 3:109883863-109883885 CCAACATAGAACTCAGGACATGG - Intergenic
959915850 3:111815967-111815989 CCAACATAGAGCTTGGGCCATGG + Intronic
959968390 3:112381453-112381475 CCAACATAGAGCTCGGGCTGTGG + Intergenic
959973403 3:112431930-112431952 ACAACATAGAGCTTGGACCATGG + Intergenic
960009281 3:112815867-112815889 CCAGCAGTGAACTTGGGCCATGG - Exonic
960021803 3:112963978-112964000 CCAACATACAGCTCAGGCCATGG + Intronic
960626533 3:119686931-119686953 CCAACATAGAGCTCAGGCCATGG - Intergenic
960842924 3:121978579-121978601 CCAACTTAGAGCTCAGGCCATGG + Intergenic
962440204 3:135406417-135406439 CCAACATAGAACTCGGGCTGTGG - Intergenic
962659397 3:137585931-137585953 CCAACGTAGAACTCGGGCTGTGG - Intergenic
962769944 3:138602800-138602822 CCAACATAGAGCTTGGGCTGTGG + Intergenic
962946278 3:140173764-140173786 CCAACATAGAGCTCAGGCCATGG - Intronic
963022502 3:140885937-140885959 CCAACACAGAGCTTGGGCCATGG + Intergenic
964737825 3:159934341-159934363 CCAAGATACAGCTTGGGCCATGG - Intergenic
964943577 3:162190741-162190763 CCAACATAGAGTTCTGGCTATGG + Intergenic
965013441 3:163126199-163126221 CCAATATAGAGCTCAGGCCTTGG - Intergenic
965127527 3:164649612-164649634 GCAACGTAGAGCTCGAGCCATGG + Intergenic
965146584 3:164913019-164913041 CCAACATAGAGCTTGGGCTGTGG - Intergenic
965198632 3:165629435-165629457 CTAACATAGAGCTCAGGCCATGG - Intergenic
965203654 3:165692939-165692961 CCAACACAGAGCTTGGGCCATGG - Intergenic
965270722 3:166613977-166613999 GCAACACAGAGCTCTGGCCATGG - Intergenic
965386880 3:168056178-168056200 CCAACATAGAGCTTGGGCTATGG + Intronic
965865043 3:173195782-173195804 CCAATGTAGAGCTCAGGCCATGG + Intergenic
966115672 3:176458206-176458228 CCAATGTAGAACTGGGTCCATGG + Intergenic
966123405 3:176548102-176548124 CCAACATAGAGCTCGGGCTGTGG - Intergenic
966665060 3:182463225-182463247 CCAACATAGAGCTTGGGCCATGG + Intergenic
967412517 3:189181042-189181064 CCAACATAGAGCTCAGGCCATGG - Intronic
967586646 3:191221964-191221986 CCAAAGTATAACTGGGGCCATGG + Intronic
967875340 3:194265046-194265068 CCAGCACAGACCCCGGGCCAGGG - Intergenic
968175912 3:196549353-196549375 CCAACATAGAGCTTGGGCTGTGG + Intergenic
969194616 4:5550875-5550897 CCAACATAGAGCTCAGGCTGTGG + Intronic
970222508 4:13825308-13825330 TCAACATGGAGCTCGGGCCGTGG + Intergenic
970339161 4:15086333-15086355 CCAACATAGAGCTTGGGCTGTGG - Intergenic
970382131 4:15518765-15518787 CCAAGGTACAACTCGGGCCATGG - Intronic
970635541 4:18005713-18005735 CCAACATAGAGCTCGGGCCGTGG - Intronic
970659227 4:18265257-18265279 CCAACATACAGTTCGGGCCATGG - Intergenic
970818932 4:20190652-20190674 CCAAGATAAAGCTCAGGCCATGG + Intergenic
970868181 4:20782565-20782587 CCAATGTAGAGCTTGGGCCAAGG - Intronic
970976513 4:22048357-22048379 CCAACATAGAGCTGGAGCCATGG - Intergenic
971069971 4:23080246-23080268 CCAAGGTACAGCTCGGGCCATGG - Intergenic
971570469 4:28204967-28204989 CCAATGTAGAACTTGGGCCATGG - Intergenic
971753305 4:30678270-30678292 CCAACATAGAACTTGGGCTGTGG + Intergenic
971815069 4:31476818-31476840 CCAACATAGAGCTCAGGCCATGG + Intergenic
972100338 4:35407581-35407603 CCAACATAGAGCTCAGGCAATGG + Intergenic
972251311 4:37305130-37305152 CCAACATAGAGCTCAGGCCGTGG - Intronic
972301222 4:37787387-37787409 CCACCATAGAGCTTGGGCCATGG + Intergenic
972301823 4:37792048-37792070 CCAATGTAGAGCTCAGGCCATGG + Intergenic
972749352 4:41973142-41973164 CCAACATAGATCTTGGACCTTGG + Intergenic
972799763 4:42462414-42462436 CCAACATAGAGTTCGGGCAGTGG + Intronic
973078617 4:45962155-45962177 CCAACATAGCACATGGGCCATGG - Intergenic
973552375 4:52048593-52048615 CCAATGTAGAGCTCTGGCCATGG - Intergenic
973718443 4:53700518-53700540 CCAACATAGAGCTTGGGCTGTGG - Intronic
974219487 4:58947977-58947999 CCAATACAGAGCTCAGGCCAAGG - Intergenic
974322498 4:60369341-60369363 CCAACATAGAGCTCAGGCCATGG + Intergenic
974455848 4:62128516-62128538 CCAACATAGAATTCGGGCTATGG + Intergenic
974492816 4:62588781-62588803 CCAAGATACAACTCAGGCCATGG - Intergenic
974494977 4:62614991-62615013 CCAACATAGAGCTCGGGCCATGG - Intergenic
974563482 4:63553201-63553223 CCAACATACCACTTGGGCCATGG - Intergenic
974679879 4:65147036-65147058 CCAACATGGAGCTTGGGCCATGG - Intergenic
974733590 4:65900108-65900130 CCAACATAGAGCTTGGGCTGTGG + Intergenic
974963364 4:68730857-68730879 CCAATGTAGAACTCAGACCATGG - Intergenic
975542905 4:75532775-75532797 CCAACATACACCTTGGGCCGTGG - Intronic
975612282 4:76214312-76214334 CCCACATTGAACTGGGGCCTGGG + Intronic
975804330 4:78096654-78096676 CCAATGTAGAGCTCAGGCCATGG - Intronic
976051102 4:81012339-81012361 CCAACATAGACATCAGGCCATGG + Intergenic
976259897 4:83135630-83135652 CCAACACAGAGCTCAGGCCGTGG - Intronic
976503146 4:85815035-85815057 CCAATGTAGAGCTCGGGCCATGG - Intronic
976674822 4:87692364-87692386 CCAACATAGAACTAGGGCCGTGG + Intergenic
977014662 4:91677877-91677899 CCAACATAGAGCTTGGGCTGTGG + Intergenic
977189121 4:93977779-93977801 CCAACAAAGAGCTCAGGCCATGG + Intergenic
977512028 4:97973734-97973756 CCAACGTAGAGCTCAGGCCGTGG + Intronic
977592462 4:98842065-98842087 CCAACATACAGCTCGGGCAGTGG + Intergenic
977973050 4:103233055-103233077 CCAACATAGAGCTCAGTCCATGG + Intergenic
978654756 4:111052088-111052110 CCAATGTAGAGCTCAGGCCATGG + Intergenic
979063532 4:116098283-116098305 ACAACAAAGAGCTAGGGCCATGG + Intergenic
979097857 4:116573719-116573741 CCAACATAGAGCTTGGGCCATGG - Intergenic
979327881 4:119400239-119400261 CCAACATAGAGCTCAGGCCGTGG - Intergenic
979405933 4:120310553-120310575 CCAACATAGAGCTCAGGCTTTGG - Intergenic
980201313 4:129658939-129658961 CCAACGTAGAGCTCAGTCCATGG - Intergenic
980368591 4:131838659-131838681 ACAACATAGAGCTCAGGCTATGG + Intergenic
980598520 4:134988176-134988198 CTAACATAGAGCTCAGGACATGG + Intergenic
980720416 4:136687623-136687645 CCAACATAGAGCTTGGGCCGTGG - Intergenic
980727839 4:136787822-136787844 CCAACATAGAGCTCAGACTATGG + Intergenic
981308063 4:143267723-143267745 CCAATGTAGAGCTCAGGCCATGG + Intergenic
982389343 4:154847760-154847782 CCAACGTAGAGCTCAGGACATGG + Intergenic
982477239 4:155868390-155868412 CCAAGGTACAACTCAGGCCATGG - Intronic
982482970 4:155934195-155934217 CCAACATAGAGCTCAGGCTGTGG + Intronic
982730757 4:158953307-158953329 CCAACATAGAGCTTGGGCCATGG + Intronic
982868220 4:160544176-160544198 CCAACATAGAGCTCAGGCTGTGG - Intergenic
983245633 4:165283960-165283982 CCAACATAGAGCTCAGGCCGTGG - Intronic
983340486 4:166454706-166454728 CCAACATAGCACTTAAGCCATGG + Intergenic
983460724 4:168023014-168023036 CCAAAGTAGAGCTCAGGCCATGG - Intergenic
983657520 4:170098300-170098322 CCAAAGTACAGCTCGGGCCATGG - Intergenic
983723855 4:170893643-170893665 CCAATGTAGAGCTCAGGCCATGG - Intergenic
984442540 4:179791484-179791506 CCAACATAGAGCTCAGGCCATGG + Intergenic
984900369 4:184580919-184580941 CCAACATAGAACTCAGGCCATGG - Intergenic
985431841 4:189888494-189888516 CCAATGTACAACTCAGGCCATGG - Intergenic
985617072 5:929460-929482 CCAAGGTACAACTTGGGCCATGG + Intergenic
985617780 5:934463-934485 CCAAGGTACAACTTGGGCCATGG - Intergenic
986756769 5:10844053-10844075 CCAACGTACAGCTTGGGCCATGG - Intergenic
986852436 5:11829484-11829506 CCAACGTAAAGCTCAGGCCATGG + Intronic
986960352 5:13203038-13203060 CCAATGTAGAGCTCGGGCCGTGG - Intergenic
986983430 5:13474858-13474880 CCAACATAACGCTCAGGCCATGG + Intergenic
987433545 5:17865311-17865333 CAAACATAGTGCTCAGGCCAGGG + Intergenic
987478893 5:18428378-18428400 CCAACATAGACCTCAGACCATGG + Intergenic
987602093 5:20084768-20084790 CCAACATAGAGCTTGGGCCATGG - Intronic
988009203 5:25461689-25461711 CCAACATAGAGCTCAGGCTATGG + Intergenic
988009594 5:25465008-25465030 CCAACTTAAAGCTCAGGCCATGG + Intergenic
988070765 5:26285347-26285369 CCAATGTAGAACTCAGGCTATGG - Intergenic
988199934 5:28054801-28054823 CCAACATAGAGCTCGGGCTGTGG - Intergenic
988471937 5:31547659-31547681 CCAACATAGAGCTCGGGCTGTGG - Intronic
988649405 5:33131759-33131781 CCAATGTAGAGCTTGGGCCATGG + Intergenic
988740116 5:34061651-34061673 CCAACATAGAGCTGGGGCCATGG - Intronic
988808902 5:34765945-34765967 CCAACATAGAACTTGGGCTGTGG + Intronic
989067815 5:37481496-37481518 CCAAGATACACCTCAGGCCATGG - Intronic
989499482 5:42149373-42149395 CCAAGATACATCTCAGGCCATGG + Intergenic
989731355 5:44654041-44654063 CCAATGTAGAGCTCAGGCCATGG - Intergenic
990193315 5:53286425-53286447 CCAACATAGAGCTTGGGCCATGG - Intergenic
990264534 5:54061219-54061241 CCAACATAGATCTCAGGCCGTGG + Intronic
990329576 5:54712783-54712805 CCAACATAGAACTCAGACTGTGG + Intergenic
990595537 5:57309315-57309337 CCAATATAGAGCTTGGGCCATGG + Intergenic
991002259 5:61794239-61794261 CCAACAGAGTACTAGAGCCATGG - Intergenic
991104940 5:62833026-62833048 CCAACATAGAGCTCGGGCCATGG - Intergenic
992138082 5:73767979-73768001 CCAACACAGAACTCGGGCCATGG + Intronic
992215828 5:74523970-74523992 CCAACGTAGAACTCGAACCATGG + Intergenic
992651564 5:78865342-78865364 CCAATGTAGAGCTTGGGCCATGG - Intronic
993309683 5:86313800-86313822 CCAACATACAGCTTGGGCTATGG + Intergenic
993391000 5:87319537-87319559 CCAATGTACAACTCGGGCCATGG - Intronic
993430961 5:87831613-87831635 CCAACATAGACCTCAGGCTGTGG - Intergenic
993569866 5:89524071-89524093 CCAATGTAGAGCTCAGGCCATGG - Intergenic
993723989 5:91347937-91347959 CCAACATAGAGCTCGGGCTGTGG - Intergenic
993801775 5:92351483-92351505 CCAACATAGAATTTGGGCTGTGG + Intergenic
994271523 5:97782983-97783005 CCAATGTAGAGCTCAGGCCATGG - Intergenic
994614937 5:102092491-102092513 CTAACATAGAGCTTGGGCTATGG - Intergenic
994655970 5:102593481-102593503 CCAATGTAGAGCTCAGGCCATGG - Intergenic
994764524 5:103900036-103900058 CCAATGTATAGCTCGGGCCATGG + Intergenic
994895615 5:105698213-105698235 CCAACGTAGAGCTTGGACCATGG - Intergenic
994900442 5:105762830-105762852 CCAAAATAGAGCTTGGTCCATGG - Intergenic
995129273 5:108612755-108612777 CCAATGTAGAACTCAGGCCATGG + Intergenic
995200012 5:109415032-109415054 CCAACATAGAGCTCAGGCCATGG + Intergenic
995392427 5:111653550-111653572 CCAACATACAGCTTGGGCTACGG - Intergenic
996030936 5:118703320-118703342 CCAACGTAGAGCTCAGGGCATGG - Intergenic
996033590 5:118733696-118733718 CAAACATAGAGCATGGGCCATGG + Intergenic
996247531 5:121282873-121282895 TCAAGGTAGAGCTCGGGCCATGG + Intergenic
997081695 5:130746933-130746955 CCAACATAGAGCTCAGGCTGTGG + Intergenic
997092954 5:130878455-130878477 CCAACACAGAACTCAGGTCATGG + Intergenic
997116128 5:131127388-131127410 CCAACATAGAGCTTGGGCTGTGG + Intergenic
999108000 5:149090927-149090949 CCAACACAGAGCTCAGGCCATGG + Intergenic
1000741456 5:164974710-164974732 CCAACGTAGAGCTCAGGCCATGG + Intergenic
1001352257 5:170980553-170980575 CCAATGTAGAGCTCAGGCCACGG + Intronic
1001795498 5:174498891-174498913 CCAAAATAGAGCTCAGGCCATGG + Intergenic
1001811847 5:174635015-174635037 CCAACGTAGAACTGGATCCAGGG - Intergenic
1002705716 5:181160040-181160062 CCCACAGGGACCTCGGGCCATGG - Intergenic
1003986660 6:11442564-11442586 CCAAGGTACAACTCAGGCCATGG + Intergenic
1005548631 6:26894369-26894391 CCAAGGTACACCTCGGGCCATGG + Intergenic
1005617434 6:27587914-27587936 ACAACAAAAAACTAGGGCCAAGG + Intergenic
1005816077 6:29553877-29553899 GCAACAGACAGCTCGGGCCACGG - Intergenic
1006217057 6:32453473-32453495 CCAACATAGAGCTCAGGCCACGG + Intergenic
1006697124 6:35940674-35940696 CCAACATAGAGCTCGGGCTGTGG + Intergenic
1007625082 6:43241707-43241729 CCAACAGACAAGTGGGGCCAGGG - Intergenic
1007856632 6:44864638-44864660 CCAACACAGAGCTCAGGACATGG - Intronic
1008756123 6:54797210-54797232 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1009289507 6:61866363-61866385 CCGACATAGAGCTCGGACCGTGG - Intronic
1009346086 6:62614243-62614265 CAAACATAGAGCTAGGGCCATGG + Intergenic
1009396608 6:63206827-63206849 CCAATATACAGCTCAGGCCATGG + Intergenic
1009480977 6:64157642-64157664 CTAACATAGAGCTTGGGCCATGG + Intronic
1009490526 6:64284802-64284824 CCAACACAGAGCTTGGGCCATGG - Intronic
1009605120 6:65857484-65857506 CCAAGGTACAACTTGGGCCATGG - Intergenic
1009634954 6:66253326-66253348 GCAAGATAGAGCTTGGGCCATGG - Intergenic
1009772466 6:68161040-68161062 CCAATGTAGAGCTCGGGCCACGG + Intergenic
1010248360 6:73682861-73682883 CCAATGTAGAGCTCGGGCCGTGG - Intergenic
1010282587 6:74038405-74038427 CCAACATAGAGCTTTGGCCATGG + Intergenic
1010530948 6:76966706-76966728 CCAATATGGAGCTCTGGCCATGG + Intergenic
1010645853 6:78386948-78386970 CCAACATAGAGCTCAGGCCATGG - Intergenic
1010884349 6:81218052-81218074 CCAACGTAGAGCTCAGGCCCTGG + Intergenic
1010920384 6:81673279-81673301 CCAATGTAGAGCTCAGGCCATGG - Intronic
1011122061 6:83964880-83964902 CCAACATGAAGCTCAGGCCATGG + Exonic
1011152537 6:84290161-84290183 CCAATGTAGAGCTCGGGCCATGG - Intergenic
1011461970 6:87614230-87614252 CCAACACAAAGTTCGGGCCACGG - Intronic
1011821195 6:91255713-91255735 CCAACTTAGAGCTCAGGCCATGG + Intergenic
1011835061 6:91421389-91421411 CCAACAAAGAGCTTGGGCCATGG + Intergenic
1012005410 6:93707632-93707654 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1012148703 6:95718618-95718640 CCAACATAGAATCAGGGCCATGG - Intergenic
1012196012 6:96342145-96342167 CCAACATAGAGCTCGGGTTGTGG - Intergenic
1012830793 6:104201498-104201520 CCAACATAGAGGTCAGGCTATGG + Intergenic
1013077003 6:106780653-106780675 CCAATGTACAGCTCGGGCCATGG + Intergenic
1013863127 6:114660456-114660478 CCAATGTAGACCTCAGGCCATGG + Intergenic
1014068156 6:117150822-117150844 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1014406984 6:121064617-121064639 CCAACGTAGAACTCAGACCATGG + Intergenic
1014449353 6:121565434-121565456 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1014670725 6:124301183-124301205 CCAAGGTACAGCTCGGGCCATGG + Intronic
1014730975 6:125031083-125031105 CCAACATACAGCTCGGGCTGTGG - Intronic
1015969625 6:138730923-138730945 CCAACATAGAGTTTGGGCCGTGG - Intergenic
1016108165 6:140188449-140188471 CCAACATAGAGCTTGGGCCATGG + Intergenic
1016202586 6:141430389-141430411 CCAACGTACAACTCGGGCTGTGG - Intergenic
1016579703 6:145616240-145616262 CCAACATAGAGCTCAGGCCATGG + Intronic
1017058175 6:150456412-150456434 CCAACCTAGAACTCGGGAGCTGG - Intergenic
1017525401 6:155237712-155237734 CCAACACAGAGCTTGAGCCATGG - Intronic
1018040992 6:159922085-159922107 CCAACATAGAGCTTGGGACATGG + Intergenic
1018132616 6:160747208-160747230 CCATCCTAGACCTGGGGCCATGG - Intronic
1018554561 6:165036335-165036357 CCAACACAGAGCTCGGGCCATGG + Intergenic
1019098678 6:169609509-169609531 CCAACATAGAGCTCATGCCATGG - Intronic
1019150437 6:170001894-170001916 CCAACATAGAGCTCAGCCCATGG - Intergenic
1020631859 7:10649563-10649585 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1020782713 7:12536338-12536360 CCAACGTAGAGCTCAGGCTATGG - Intergenic
1021036852 7:15810049-15810071 CCAAAGTAGAGCTAGGGCCATGG - Intergenic
1021529823 7:21632114-21632136 CCAACATAGAGCTCGGGACGTGG - Intronic
1021598604 7:22342203-22342225 CCAACATAGAGCTCAGGCTTTGG - Intronic
1021646760 7:22796511-22796533 CCAACATAGAGCTCAGGCCATGG - Intergenic
1022521134 7:31007678-31007700 CCAGCATAGAACAGGGGCAACGG + Intergenic
1024438578 7:49388329-49388351 CCAACATGGAGCTCAGTCCATGG - Intergenic
1025285762 7:57659529-57659551 CCAACATAGAACTCAGGCCATGG + Intergenic
1025300384 7:57815235-57815257 AAAACATAGAACTCAGGCCATGG - Intergenic
1026120138 7:67529617-67529639 CCAACATACAGCTCGGGCTGTGG - Intergenic
1027549544 7:79573884-79573906 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1027624743 7:80531985-80532007 CCAACATAGAGCTCGGGCCACGG + Intronic
1028126090 7:87114967-87114989 CCAATGTAGAGCTTGGGCCATGG + Intergenic
1028249714 7:88526390-88526412 CCAACAAACAGCTCGGGCTATGG - Intergenic
1028360031 7:89956131-89956153 CCAATGTAGAGCTTGGGCCATGG - Intergenic
1028624542 7:92863182-92863204 CCAACATAGAGCTCAGGCCATGG - Intergenic
1028668365 7:93372519-93372541 CCAACATAGAGCTCAGGCCGTGG - Intergenic
1028745316 7:94320574-94320596 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1030144698 7:106341398-106341420 CCAACATAGAGCTCAGGCCATGG - Intergenic
1030452565 7:109731227-109731249 CCAACGTAGAGCTAAGGCCATGG - Intergenic
1030627620 7:111860859-111860881 CCAACAAGGAACTGGGCCCAAGG + Intronic
1030868756 7:114731406-114731428 CCAAAGTAGAGCTTGGGCCATGG + Intergenic
1031230179 7:119095979-119096001 CCAAGGTAGAGCTCAGGCCATGG - Intergenic
1031677902 7:124633988-124634010 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1031732856 7:125319886-125319908 CCAAAGTAGAGCTCGGGCCATGG + Intergenic
1031783290 7:125997463-125997485 CCAACATAGAGCTCGGGCTGTGG + Intergenic
1032179222 7:129661093-129661115 CCAACACAGAGCTCGGGCCATGG - Intronic
1039657288 8:39423554-39423576 CCAACATAGAGCTCGGGCTGTGG - Intergenic
1040094842 8:43433450-43433472 CCAACATAGAGCTTCAGCCATGG + Intergenic
1040397211 8:47011327-47011349 CCAACATAAAGCTTGGTCCATGG - Intergenic
1040844080 8:51817549-51817571 CAAACATAAAAGTCAGGCCATGG + Intergenic
1041074969 8:54161064-54161086 CCAACGTAGAGCTCGGGCTGTGG + Intergenic
1041865794 8:62571782-62571804 CCAACATAGAGCTCAGGACAAGG - Intronic
1041984852 8:63909505-63909527 CCAACGTAGAGCTTGGGCCATGG - Intergenic
1042646092 8:70987971-70987993 CCAACGTAGAGCTCGAGCAATGG - Intergenic
1042772968 8:72398989-72399011 CCAACATACAGCTCAGGCCATGG - Intergenic
1042923097 8:73939558-73939580 CCAACATAGAGTTTGGGCCGTGG + Intronic
1043834723 8:85033326-85033348 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1043993117 8:86780585-86780607 CCAATGTAGAACTTAGGCCATGG + Intergenic
1044125315 8:88452323-88452345 CCAACATAGAGCTCAGGCCATGG - Intergenic
1044194069 8:89353440-89353462 CCAACCTAGAGCTCAGTCCATGG - Intergenic
1045053621 8:98349756-98349778 CCAATGTACAACTCAGGCCATGG - Intergenic
1045067218 8:98459732-98459754 CCAAGGTACAGCTCGGGCCATGG + Intronic
1045995668 8:108358961-108358983 CCAATGTACAGCTCGGGCCATGG - Intronic
1046368643 8:113271461-113271483 CCAAGGTACAGCTCGGGCCATGG + Intronic
1046506764 8:115146761-115146783 CCAAGGTACAACTTGGGCCATGG - Intergenic
1046689598 8:117267787-117267809 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1046703244 8:117424166-117424188 CCAACATAGAGCTCAGCCCATGG - Intergenic
1047149146 8:122241213-122241235 CCAGTATAGAGCTTGGGCCATGG + Intergenic
1047865860 8:129023692-129023714 CCAACGTAGAACTCAAGCTATGG + Intergenic
1047924490 8:129669549-129669571 CCATGATACAACTCAGGCCATGG + Intergenic
1047941458 8:129830913-129830935 CCAACATAGAGCTCAGGTCATGG - Intergenic
1048699992 8:137077962-137077984 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1048769712 8:137882607-137882629 CCAACATAGAGCTTGGGCCGTGG + Intergenic
1048895791 8:138990972-138990994 CCAACATAGAGTTCAGGCCATGG - Intergenic
1048915838 8:139182023-139182045 CCAACATACAGCTCAGGCCACGG + Intergenic
1049076289 8:140399009-140399031 CCAACATACAGCTCGGGCCATGG + Intronic
1049085778 8:140477538-140477560 CCAACATAGAGCTTGGGCCGTGG - Intergenic
1049448938 8:142648479-142648501 CCAACATAGAGCTCAGGTCATGG + Intergenic
1050182059 9:2933351-2933373 CCAAGACAGAACTGGGCCCAGGG + Intergenic
1050255602 9:3789311-3789333 CCAACATAGAGCTTGGGCTGTGG + Intergenic
1050691501 9:8232418-8232440 GCAACATACAACTCTGGCCTTGG - Intergenic
1050805375 9:9670687-9670709 CCAACATAGAGCTCAGGCTGTGG + Intronic
1050832257 9:10029045-10029067 CCAACATAGAGCTCAGGCCATGG + Intronic
1051089056 9:13385115-13385137 CCAACATAGAGCTCAGGCCATGG + Intergenic
1051309783 9:15757803-15757825 CCAACGTAGAGCTTGGTCCATGG + Intronic
1051619504 9:19036555-19036577 CCAACATAGAGCTTGGGCCATGG + Intronic
1051946209 9:22572904-22572926 CCAATATGGAGCTCAGGCCATGG + Intergenic
1052218078 9:25990466-25990488 CCAATGTAGAACTCAGGCCATGG - Intergenic
1052220644 9:26017720-26017742 CCAACATAGAGCTCAGGCTGTGG - Intergenic
1052846421 9:33340329-33340351 CCAACACAGAGCTTGGGCCAAGG - Intronic
1053632957 9:39964383-39964405 ACAACATAGAGCTCAGGCTATGG + Intergenic
1053772796 9:41499150-41499172 ACAACATAGAGCTCAGGCTATGG - Intergenic
1053793434 9:41703452-41703474 AAAACATAGAACTCAGGCCACGG + Intergenic
1054151742 9:61611378-61611400 ACAACATAGAACTCAGGCCATGG - Intergenic
1054181843 9:61915467-61915489 AAAACATAGAACTCAGGCCATGG + Intergenic
1054210931 9:62286314-62286336 ACAACATAGAGCTCAGGCTATGG - Intergenic
1054314053 9:63562540-63562562 ACAACATAGAGCTCAGGCTATGG + Intergenic
1054471514 9:65542517-65542539 AAAACATAGAACTCAGGCCATGG - Intergenic
1055175595 9:73314049-73314071 CCAATGTAGAGCTCAGGCCATGG - Intergenic
1055223814 9:73969959-73969981 CCAAGGTACAACTTGGGCCATGG + Intergenic
1055264108 9:74475821-74475843 CCAATGTAGAGCTCGGGTCATGG + Intergenic
1055341915 9:75293119-75293141 CCAACATGGAGCTTGGGCCATGG - Intergenic
1055363959 9:75524740-75524762 CCCACATAGAGCTCAGGCCATGG + Intergenic
1055878457 9:80970664-80970686 CCATTATAGAGCTCGGGCCATGG + Intergenic
1055968192 9:81885642-81885664 CCAACACAGAGCTAAGGCCAAGG - Intergenic
1056012448 9:82346319-82346341 CCAACGTAGAGCTCAAGCCATGG + Intergenic
1056595141 9:88001900-88001922 CCACCATAGAGCTCCAGCCATGG + Intergenic
1056639376 9:88357594-88357616 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1057732479 9:97622246-97622268 CCAATGTAGAATTCAGGCCATGG + Intronic
1058082253 9:100712599-100712621 CCAACATAGAGCTCAGGCCGTGG - Intergenic
1058174516 9:101722161-101722183 CCAACATAGAGCTCAGGCTGTGG + Intronic
1058380436 9:104371714-104371736 CCAATATAGAGCTCGAACCATGG + Intergenic
1058401533 9:104625185-104625207 CCAATGCAGAGCTCGGGCCATGG + Intergenic
1059195393 9:112366499-112366521 CCAATATAGAGCTTGGGCCATGG + Intergenic
1060311932 9:122470297-122470319 CCAACATAGAGCTCAGGCCATGG + Intergenic
1061070827 9:128309576-128309598 CCAAGGTAGAGCTCGGGCCCTGG + Exonic
1062616957 9:137401664-137401686 CCAACATAGAGCTCGGGCTGTGG - Intronic
1186222713 X:7366556-7366578 CTAACCTAGAGCTCTGGCCATGG + Intergenic
1186797666 X:13062413-13062435 CCAACATAGAGCTTGGGCCATGG - Intergenic
1186954740 X:14669636-14669658 CCAACATAGAGCTCAGGCTGTGG - Intronic
1186992426 X:15084458-15084480 CCAACATAGACCTCGGGTTGTGG + Intergenic
1188624316 X:32265246-32265268 CCAAGATAGAGCTCAGCCCATGG + Intronic
1188753836 X:33936207-33936229 CCAACATAGAGCTCTGGCCATGG - Intergenic
1188785105 X:34336240-34336262 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1188794227 X:34442161-34442183 CTGACATAGAGCTCAGGCCATGG - Intergenic
1189637213 X:43023700-43023722 CCAACATAGAGCTCAGGCTATGG - Intergenic
1190513300 X:51195777-51195799 CCAACATAGAGCTTGGGCCATGG - Intergenic
1191211469 X:57889492-57889514 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1192162453 X:68798681-68798703 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1192270560 X:69575420-69575442 CCAACATAGAGCTTGGGCCATGG - Intergenic
1192846270 X:74909833-74909855 CCAACGTACAGCTCGGCCCATGG + Intronic
1193226448 X:78989638-78989660 CCAATGTAGAACTTGGGCCATGG + Intergenic
1193307953 X:79972146-79972168 CAAACATAGAGCTCAGGCCATGG + Intergenic
1193662522 X:84274429-84274451 CCAATGTAGATCTTGGGCCATGG - Intergenic
1193750300 X:85334189-85334211 CCAAGATAGAAGTCGTCCCAAGG + Intronic
1193797208 X:85891480-85891502 CCAACATAGAGCTCAGGCTGTGG + Intronic
1193842044 X:86418532-86418554 CCAACATAGAGCTGGGACCATGG - Intronic
1194089086 X:89563702-89563724 CCAACATATAGCTCAGGCCGTGG - Intergenic
1194215804 X:91129049-91129071 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1194220450 X:91183244-91183266 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1194256907 X:91646092-91646114 CCAACATAGAGTTTGGGCCATGG + Intergenic
1194288332 X:92038394-92038416 CCAACATGGAACTCAGGCCATGG + Intronic
1194352710 X:92840260-92840282 CCAAGGTACATCTCGGGCCATGG - Intergenic
1194397550 X:93404196-93404218 CCAACGTACAACTTAGGCCATGG - Intergenic
1194662101 X:96639081-96639103 CCAACATAGAGCTTGGGCCGTGG + Intergenic
1196223577 X:113139452-113139474 CCAAGATACAGCTTGGGCCATGG - Intergenic
1196540403 X:116900549-116900571 CCAACATATAGCTCGGACCGTGG - Intergenic
1196543290 X:116934446-116934468 CCAATATAGAGCTCAGGCCATGG + Intergenic
1196559298 X:117126550-117126572 ACAACATAGAGCTTGGGCCATGG + Intergenic
1196973885 X:121138042-121138064 ACAACATAGAGCTCAGGCCATGG - Intergenic
1197061330 X:122184866-122184888 CCAACATAGAGCTTGGGCTGTGG - Intergenic
1197092554 X:122556168-122556190 CCAATGTAGAGCTCAGGCCATGG + Intergenic
1197341011 X:125266440-125266462 CTAATGTAGAGCTCGGGCCATGG + Intergenic
1197560545 X:128015097-128015119 CCAAGGTACAGCTCGGGCCATGG - Intergenic
1197774096 X:130109151-130109173 CCAACCTGGCACTCGGGCCAGGG + Intronic
1198569760 X:137942306-137942328 CCAACATGGAGCTTGGGCCATGG + Intergenic
1198734602 X:139772152-139772174 CCAACGTAGAGCTTAGGCCATGG + Intronic
1198857490 X:141033397-141033419 CCAACACAGAGCTCAGGCCGTGG + Intergenic
1198905206 X:141553974-141553996 CCAACACAGAGCTCAGGCCGTGG - Intergenic
1199820798 X:151443537-151443559 CCAACATAGAGCTCGGGCTGTGG + Intergenic
1200441754 Y:3219752-3219774 CCAACATATAGCTCAGGCCGTGG - Intergenic
1200556962 Y:4646996-4647018 CCAACATAGAGCTCAGGCTGTGG + Intergenic
1200575626 Y:4885359-4885381 CCAACATAGAGTTTGGGCCATGG + Intergenic
1200605855 Y:5262959-5262981 CCAACATGGAACTCAGGCCATGG + Intronic
1200661015 Y:5957002-5957024 CCAAGGTACATCTCGGGCCATGG - Intergenic
1201402803 Y:13621190-13621212 CCAACATACAGCTAAGGCCATGG - Intergenic