ID: 1079799813

View in Genome Browser
Species Human (GRCh38)
Location 11:24854712-24854734
Sequence CACAAAATGGGGCAGTTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 3, 2: 13, 3: 135, 4: 366}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079799813_1079799826 25 Left 1079799813 11:24854712-24854734 CCAAACAACTGCCCCATTTTGTG 0: 1
1: 3
2: 13
3: 135
4: 366
Right 1079799826 11:24854760-24854782 TAGGCACCTGAGGGAATCTCCGG 0: 4
1: 3
2: 4
3: 17
4: 126
1079799813_1079799825 16 Left 1079799813 11:24854712-24854734 CCAAACAACTGCCCCATTTTGTG 0: 1
1: 3
2: 13
3: 135
4: 366
Right 1079799825 11:24854751-24854773 CTGGTGGTGTAGGCACCTGAGGG 0: 80
1: 253
2: 435
3: 477
4: 582
1079799813_1079799827 26 Left 1079799813 11:24854712-24854734 CCAAACAACTGCCCCATTTTGTG 0: 1
1: 3
2: 13
3: 135
4: 366
Right 1079799827 11:24854761-24854783 AGGCACCTGAGGGAATCTCCGGG 0: 146
1: 399
2: 606
3: 536
4: 523
1079799813_1079799818 0 Left 1079799813 11:24854712-24854734 CCAAACAACTGCCCCATTTTGTG 0: 1
1: 3
2: 13
3: 135
4: 366
Right 1079799818 11:24854735-24854757 CTTGAAACCCAGTGCCCTGGTGG 0: 10
1: 576
2: 638
3: 386
4: 394
1079799813_1079799819 6 Left 1079799813 11:24854712-24854734 CCAAACAACTGCCCCATTTTGTG 0: 1
1: 3
2: 13
3: 135
4: 366
Right 1079799819 11:24854741-24854763 ACCCAGTGCCCTGGTGGTGTAGG 0: 4
1: 350
2: 575
3: 607
4: 623
1079799813_1079799824 15 Left 1079799813 11:24854712-24854734 CCAAACAACTGCCCCATTTTGTG 0: 1
1: 3
2: 13
3: 135
4: 366
Right 1079799824 11:24854750-24854772 CCTGGTGGTGTAGGCACCTGAGG 0: 80
1: 237
2: 415
3: 489
4: 649
1079799813_1079799817 -3 Left 1079799813 11:24854712-24854734 CCAAACAACTGCCCCATTTTGTG 0: 1
1: 3
2: 13
3: 135
4: 366
Right 1079799817 11:24854732-24854754 GTGCTTGAAACCCAGTGCCCTGG 0: 7
1: 597
2: 624
3: 363
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079799813 Original CRISPR CACAAAATGGGGCAGTTGTT TGG (reversed) Intronic
900039003 1:441291-441313 CACAAAACTAGGCAGCTGTTTGG + Intergenic
900060435 1:676267-676289 CACAAAACTAGGCAGCTGTTTGG + Intergenic
906739982 1:48173303-48173325 CACAAAACTGGGCGGCTGTTTGG - Intergenic
907600084 1:55760437-55760459 CACAAAATGGGGTGGCTGTTTGG + Intergenic
907796205 1:57720412-57720434 GGCAATATGGGGCAGTGGTTAGG - Intronic
908051759 1:60240453-60240475 CACACACTGGGGCAGTTGTGGGG - Intergenic
908570792 1:65408012-65408034 CATAAAATGGGGATGGTGTTAGG - Intronic
908592840 1:65652039-65652061 CACAAAACTGGGCAGCTGTTTGG + Intergenic
908601435 1:65744308-65744330 CACAAAACTGGGCAGCTGCTTGG - Intergenic
908611450 1:65865479-65865501 CAAAAAACTGGGCAGCTGTTTGG - Intronic
908903813 1:68985415-68985437 CACAAAACTGGGCAGCTGTTTGG + Intergenic
909384203 1:75036722-75036744 CACAAAACTGGGCAGCTGTTTGG + Intergenic
909493167 1:76247905-76247927 CACAAAACTGGGCGGCTGTTTGG - Intronic
910177170 1:84443127-84443149 CACAAAACTGGGCGGCTGTTTGG + Intergenic
910604812 1:89071931-89071953 CACAAAACTGGGCAGCTGTTTGG + Intergenic
911512493 1:98824920-98824942 CATAAAAAGGGGAAGTGGTTTGG - Intergenic
911541390 1:99162313-99162335 CACAAAACTGGGCAGCTGTTGGG - Intergenic
912076763 1:105884787-105884809 CACAAAACTGGGCAGACGTTTGG - Intergenic
912530024 1:110313626-110313648 CACAAAATGGGATAATTATTTGG + Intergenic
913021487 1:114792421-114792443 CACAAAACTGGGCGGCTGTTTGG - Intergenic
914886028 1:151585081-151585103 GGGAAGATGGGGCAGTTGTTCGG - Intergenic
915278461 1:154806104-154806126 CAGGAAATGGGGCCGTTGTGGGG + Intronic
915771801 1:158433128-158433150 CACAAAACTGGGTAGCTGTTTGG - Intergenic
915834746 1:159167671-159167693 CACAAAATCTGGCATTTGATGGG + Intergenic
916140506 1:161693207-161693229 CACAAAACTGGGCAGCTGTTTGG + Intergenic
916938510 1:169656320-169656342 CACAAAACTGGGCGGCTGTTTGG + Intergenic
917019342 1:170569232-170569254 CACAAAACTGGGCAACTGTTTGG + Intergenic
917274601 1:173318903-173318925 TACAAAACTGGGCAGTTGTTTGG + Intergenic
917405937 1:174708702-174708724 CATAAAACTGGGCAGTCGTTTGG + Intronic
918195624 1:182218819-182218841 CACAAAACTGGGCAGCTGTTTGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
921484900 1:215703897-215703919 CACAAAACCAGGCAGCTGTTTGG - Intronic
921953769 1:220960614-220960636 TAAAAAATGGGGCAGAGGTTGGG - Intergenic
922406255 1:225316434-225316456 CACAAAACTGGGCGGCTGTTTGG - Intronic
924180015 1:241431029-241431051 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1063720630 10:8577401-8577423 CAGAAAATGTGGCAATTCTTTGG + Intergenic
1064812321 10:19214293-19214315 CATAAATTAGGGCAGTTGATAGG + Intronic
1065427375 10:25619540-25619562 CACAAAACTGGGCAACTGTTTGG + Intergenic
1065621575 10:27587379-27587401 CACAAAACTGGGCGGCTGTTTGG + Intergenic
1066159624 10:32714459-32714481 CACAAAACTGGGCAGCTGTTTGG + Intronic
1066241349 10:33538786-33538808 CAAAAAATGGAGCAAATGTTAGG - Intergenic
1066574709 10:36812779-36812801 CACTAAATGGAGAAATTGTTTGG - Intergenic
1066993534 10:42539788-42539810 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1067209728 10:44249992-44250014 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1067239144 10:44475438-44475460 CACAAAATCGGCCAGTTCCTGGG + Intergenic
1067251978 10:44594183-44594205 GACAAAACTGGGCAGCTGTTTGG + Intergenic
1067329484 10:45301636-45301658 CACAAAACTGGGCAGCTCTTTGG - Intergenic
1067680820 10:48439190-48439212 AACAAAATGGGGCACTTTTTAGG + Exonic
1069139953 10:64810519-64810541 CACAAAAGTGGGCAGCTGTTTGG - Intergenic
1069264325 10:66438775-66438797 CACGAAACTGGGCAGCTGTTTGG - Intronic
1070234498 10:74609320-74609342 CACAAAACTGGGCTGCTGTTTGG - Intronic
1070999695 10:80817919-80817941 CACAAAACTGGGCTGCTGTTTGG + Intergenic
1071053188 10:81475712-81475734 CAAAAGATGGGGCAGTTGCAAGG + Intergenic
1072404370 10:95136243-95136265 CACAAAAGTGGGCAGCCGTTTGG + Intergenic
1074200269 10:111228356-111228378 CACAGAATGAGGAACTTGTTTGG + Intergenic
1075520613 10:123141502-123141524 CACAAAAAGGGGCCTTTTTTGGG + Intergenic
1076965211 11:77202-77224 CACAAAACTAGGCAGCTGTTTGG + Intergenic
1077972528 11:7209822-7209844 CATAAAATGGGAAATTTGTTTGG + Intergenic
1078340169 11:10492973-10492995 CACAGAATGGGGCAGTGGCAAGG + Intronic
1078743463 11:14090244-14090266 CACAAAACTGGGCGGCTGTTTGG - Intronic
1078879496 11:15434072-15434094 CACAAAATGGGGTAGTAGCTGGG - Intergenic
1079264829 11:18921140-18921162 CACAATATTGGGCAGCTGTTTGG + Intergenic
1079267004 11:18943287-18943309 CACAATATTGGGCAGCTGTTTGG + Intergenic
1079714868 11:23731949-23731971 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1079799813 11:24854712-24854734 CACAAAATGGGGCAGTTGTTTGG - Intronic
1080710022 11:34737883-34737905 CACAAAACTGGACAGTCGTTTGG + Intergenic
1081080240 11:38732172-38732194 CATAAAACTGGGCAGTTGTTTGG - Intergenic
1081118246 11:39232130-39232152 CACAAAATTGGGCAGCTGTTTGG + Intergenic
1081166009 11:39810012-39810034 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1082636389 11:55599509-55599531 CACAAAATGGAGCTGCTGGTTGG + Intergenic
1082833391 11:57635863-57635885 CATAAAATGGGCCAGTAGGTGGG + Intergenic
1082876360 11:57992773-57992795 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1082977581 11:59088336-59088358 CACAAAAAGGGGAAGTCTTTAGG - Intergenic
1083385563 11:62306743-62306765 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1083535077 11:63459933-63459955 CACAAAACTGGGCGGCTGTTCGG - Intergenic
1084679952 11:70661155-70661177 CCCAGAATGGGGCAGTTTCTAGG + Intronic
1086086072 11:82956468-82956490 CACAAAACTGGACAGCTGTTTGG - Intronic
1086143247 11:83522047-83522069 CACACAATGGGGCAGTGGTAAGG - Intronic
1086300370 11:85421047-85421069 CACAAAACTGGGCAGCTGTTTGG - Intronic
1086505256 11:87497738-87497760 CACAAAACTGGGCAGCTGCTTGG + Intergenic
1086531753 11:87794643-87794665 CACACACTGGGGCAGATGTGGGG - Intergenic
1087703832 11:101466806-101466828 CACAAAACTGGGCGGCTGTTTGG - Intronic
1087970489 11:104475237-104475259 CACAACATGTGGCATTTTTTGGG - Intergenic
1088211968 11:107466537-107466559 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1088840557 11:113624162-113624184 CTCAAAATGGGGAAGTTAATGGG - Intergenic
1089285508 11:117405235-117405257 CACAAAACTGGGCAGTCATTTGG - Intronic
1089786389 11:120910391-120910413 CACAAACTGGGCCAGTTGGGTGG + Intronic
1090312655 11:125755972-125755994 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1090688829 11:129156148-129156170 CACAAAATTGGGCAGCCATTTGG + Intronic
1090811652 11:130249816-130249838 CACAAAACTGGGCGGCTGTTTGG + Intronic
1091712121 12:2749495-2749517 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1092628988 12:10358627-10358649 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1093004385 12:14035834-14035856 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1093402268 12:18761011-18761033 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1093664505 12:21795636-21795658 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1094473771 12:30825694-30825716 CACAAACAGTGGGAGTTGTTGGG + Intergenic
1094755361 12:33462775-33462797 CACAAAATTGGGCAGCCCTTTGG + Intergenic
1095356383 12:41280272-41280294 CACAAAATTGGGCAGCCATTTGG + Intronic
1095406302 12:41870580-41870602 CAAAAAACTGGGCAGCTGTTTGG + Intergenic
1095488451 12:42708250-42708272 CACAAAACTGGGCGGATGTTTGG + Intergenic
1095920665 12:47526671-47526693 CACAAAACAGGGCGGCTGTTTGG - Intergenic
1097635232 12:62114073-62114095 CACAAAATTGGGTGGCTGTTTGG - Intronic
1097737347 12:63196579-63196601 CACAAAAGTTGGCAGCTGTTTGG + Intergenic
1098438825 12:70497286-70497308 CACAAAACTGAGCAGTTGTTTGG - Intergenic
1098635588 12:72780258-72780280 CACAAAACTGGGCAGCCGTTTGG + Intergenic
1098840035 12:75467205-75467227 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1099107852 12:78518973-78518995 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1099253754 12:80289980-80290002 CACAAAACTGGGCAGCTGTTTGG - Intronic
1099435305 12:82635270-82635292 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1099943986 12:89223082-89223104 CACAAAACTAGGCAGCTGTTTGG - Intergenic
1100330592 12:93578244-93578266 AACAGAATGGGACAGTTGTTTGG + Intronic
1100442896 12:94633543-94633565 CACAAAGAGGGGCAAATGTTTGG - Intronic
1100768775 12:97898385-97898407 CCCAAAACTGGGCAGCTGTTGGG - Intergenic
1102324363 12:111966618-111966640 CATAAAATGGGGCTATGGTTTGG + Intronic
1103169196 12:118799249-118799271 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1104115641 12:125746628-125746650 CGCAAAATTGGGCAGCCGTTTGG - Intergenic
1105316434 13:19269862-19269884 CACAAAACTGGGCAGCAGTTTGG + Intergenic
1105324262 13:19355793-19355815 GCTAAGATGGGGCAGTTGTTGGG - Intergenic
1105769372 13:23594160-23594182 CACAAAACTGGGCAGCTGTTTGG + Intronic
1105869002 13:24487611-24487633 GCTAAGATGGGGCAGTTGTTGGG + Intronic
1106042105 13:26103305-26103327 CACAAAACTGAGCAGCTGTTTGG + Intergenic
1106378847 13:29216457-29216479 CACAAAATAGAGCAGCTATTGGG - Intronic
1106874271 13:34054852-34054874 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1107616104 13:42170112-42170134 CACAGAATTGGACAGTTGTCTGG - Intronic
1107840343 13:44450903-44450925 CACACACTGGGGCAGCCGTTTGG + Intronic
1108235008 13:48394310-48394332 CACAAAACTGGGCAGCTGTTTGG + Intronic
1108236798 13:48416490-48416512 CACAAAACTGGGCAGCCGTTTGG + Exonic
1108409375 13:50131307-50131329 CACAAAATGGGTCATGTTTTCGG + Intronic
1108418824 13:50228254-50228276 CTCAAAGTGGGCCAGTTCTTAGG + Intronic
1108536780 13:51389635-51389657 CACAAAATGGGATTGTTGGTTGG - Intronic
1108940525 13:55947698-55947720 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1108998283 13:56763202-56763224 CACAAAAATGGGCAGCTGTTTGG + Intergenic
1109195891 13:59377180-59377202 CACAAAACTGGGCGGCTGTTTGG + Intergenic
1109626659 13:64983105-64983127 CACAAAATTGGGCGGCTGTTTGG - Intergenic
1110247722 13:73345926-73345948 CACAAAACTGGGCAGCTATTTGG - Intergenic
1110261824 13:73493349-73493371 CACAAAGTGAGCCAGTTCTTGGG - Intergenic
1110337237 13:74346627-74346649 CATAAAACTGGGCGGTTGTTGGG + Intergenic
1110891069 13:80699378-80699400 CGCACAATGGGCCTGTTGTTGGG - Intergenic
1111017636 13:82402354-82402376 CACAAAACTGAGCAGCTGTTTGG + Intergenic
1111147598 13:84204879-84204901 CTCCAAATAGGGCATTTGTTTGG + Intergenic
1111244613 13:85519451-85519473 CACCTAATGAGGTAGTTGTTGGG - Intergenic
1112546545 13:100376887-100376909 CACAAAACTGGGCGGCTGTTTGG - Intronic
1113448484 13:110388483-110388505 CTAAAAATGGGGCAGCAGTTTGG - Intronic
1114695523 14:24623812-24623834 CACAAAACTGGGCAGCTATTTGG - Intergenic
1114844861 14:26308971-26308993 CACAAAACTGGGCAGTTGTTTGG + Intergenic
1115124150 14:29972376-29972398 CACAAAACTGGGCGGTTATTTGG + Intronic
1115281544 14:31668637-31668659 CACAAAACTGGGCAGCTGCTTGG - Intronic
1115339045 14:32272769-32272791 CAGAAAACTGGGCAGCTGTTTGG + Intergenic
1115357124 14:32460628-32460650 CACAAAACTGGGCAGCTGTTTGG + Intronic
1116743820 14:48792521-48792543 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1117172350 14:53113786-53113808 CACATAACTGGGCAGCTGTTTGG + Intronic
1120137241 14:80884716-80884738 CACAAAACTGGGCAGCTGTTTGG + Intronic
1120298932 14:82680900-82680922 GACAAAACCAGGCAGTTGTTTGG + Intergenic
1120338611 14:83190382-83190404 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1121595880 14:95161841-95161863 GACAGAGTGGGGCAGTTGTTGGG + Intergenic
1123091061 14:105742525-105742547 CACACAAAGGGGCAGGTGCTGGG - Intergenic
1124084167 15:26531416-26531438 CACAAAACTGGGCAGCCGTTTGG + Intergenic
1125227131 15:37408209-37408231 CACAAAACTGGGCAGTCATTTGG + Intergenic
1126050798 15:44683148-44683170 CACAAAACTGGGCAGCTGTTTGG + Intronic
1126241453 15:46449325-46449347 CAGAAAGTGGGGCAGTTGTCAGG + Intergenic
1126500589 15:49340199-49340221 CACAAAACTGGGCGGCTGTTTGG - Intronic
1128795722 15:70465143-70465165 CACAAAGTGGGCCAGGTGTCTGG + Intergenic
1128857557 15:71032076-71032098 CACAAAACTGGGCAGCTGTTTGG - Intronic
1129742982 15:77999097-77999119 CACAAAATAGGCCAGTTCCTAGG + Intronic
1131825389 15:96318248-96318270 ATTAAAATAGGGCAGTTGTTGGG - Intergenic
1134901454 16:17941670-17941692 AATAATATGGGGCATTTGTTTGG + Intergenic
1143861425 17:9893739-9893761 TATAAAATGGCGCAGCTGTTGGG - Intergenic
1149222844 17:54435905-54435927 CACAAAACTAGGCAGCTGTTAGG + Intergenic
1149804477 17:59602263-59602285 CTGAAGTTGGGGCAGTTGTTGGG + Intronic
1150478380 17:65490899-65490921 GAAAAAATGGGGCAGCAGTTGGG - Intergenic
1150478561 17:65492086-65492108 CAAAAGATGGGGCAGGCGTTGGG + Intergenic
1151181749 17:72334228-72334250 TATAAAATGGGGCTGTTGTGAGG - Intergenic
1151182079 17:72336523-72336545 CACAAAATGGGGCTGAGGTGGGG - Intergenic
1153347727 18:4046176-4046198 AACAAAATCGTGCAGTTTTTTGG + Intronic
1153717887 18:7869279-7869301 CACAAAATTGGGCAGCTGTTTGG - Intronic
1155381058 18:25223296-25223318 CACAAAATGTGGCATCTGTGTGG - Intronic
1155499266 18:26470864-26470886 CACACAGAGGGGCAGTTGTCAGG + Intronic
1156230791 18:35152284-35152306 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1156555732 18:38065968-38065990 CAGAAATAGGGGCAGTGGTTTGG + Intergenic
1157224577 18:45851076-45851098 CCCAAAATTGGGAAGTTGGTAGG - Exonic
1158461365 18:57648809-57648831 ATCAAAATGGGGCAGGTGTCAGG - Intronic
1160642016 19:146832-146854 CACAAAACTAGGCAGCTGTTTGG + Intergenic
1161123667 19:2544204-2544226 AACAAAATGGAACAGTAGTTTGG + Intronic
925252487 2:2451775-2451797 CACAAAACTGGGCAGCTGTTTGG - Intergenic
925672609 2:6327305-6327327 CCCAAAATGGGGCACGTGTTTGG + Intergenic
925692307 2:6537728-6537750 CACAAAACTGGGCAGCTGTTTGG + Intergenic
925809990 2:7690356-7690378 TACAAAATGAGGCAGTTTTTTGG - Intergenic
926483489 2:13427886-13427908 CACAAAACTGGGCGGCTGTTTGG - Intergenic
926615819 2:14995714-14995736 CAAAAAAGGGGGAAGTTCTTTGG - Intergenic
928473527 2:31599386-31599408 CTCAAAATGGGCCATATGTTAGG + Intergenic
928488240 2:31754393-31754415 CACAAAACTAGGCAGCTGTTTGG + Intergenic
928576752 2:32663256-32663278 CACAAAACTGGGCAGCCGTTTGG - Intronic
928675814 2:33649923-33649945 CACAAAATGGGGCAATTCCGTGG - Intergenic
928750607 2:34466567-34466589 CACAAAACTGGACAGATGTTTGG + Intergenic
928880129 2:36088441-36088463 CACAAAACTGGGCGGCTGTTTGG + Intergenic
929062945 2:37941985-37942007 CACAAAAGTGGGCAGCTGTTTGG - Intronic
930176092 2:48303033-48303055 CACAAAACTGGGCAGCTGTTTGG - Intergenic
930860380 2:56065631-56065653 CACAAAACTGGGCAGCTGTTTGG - Intergenic
931212127 2:60207412-60207434 CACAAAACTGGGCGGCTGTTTGG - Intergenic
933168609 2:79100148-79100170 CACAGACTGGGGCAGGGGTTAGG + Intergenic
933324200 2:80815162-80815184 CACAAAACTGGGCAGCTGTTTGG + Intergenic
934706149 2:96482994-96483016 CAGAAAAGGGGACAGTTGTGAGG + Intergenic
936769560 2:115895179-115895201 CACAAAACTGGGCAGCTGTTTGG - Intergenic
936900075 2:117472538-117472560 CCCAAAATTGAGCAGCTGTTCGG + Intergenic
938485526 2:131703263-131703285 CACAAATTGGGTCTGTTGTAGGG + Intergenic
939946883 2:148421483-148421505 CACAAAATTGGGTGGCTGTTTGG + Intronic
940124809 2:150311362-150311384 CACAAAACTGGGTGGTTGTTTGG + Intergenic
940757905 2:157704537-157704559 CACAAAACTGGGCAGCCGTTTGG + Intergenic
941478010 2:165971840-165971862 CACAAAACTGGGCGGATGTTTGG + Intergenic
941518762 2:166511666-166511688 CACAAAACTGGGCTGCTGTTTGG - Intergenic
941565387 2:167099589-167099611 CACAAAATTGGGCAGCTGTTTGG - Intronic
941571548 2:167176202-167176224 CACGAAACTGGGCAGCTGTTTGG - Intronic
941963570 2:171277609-171277631 CAGAAAATGGCGAAGTTGTCAGG + Intergenic
942010902 2:171761617-171761639 CACAAAACTGGGCGGCTGTTTGG - Intergenic
942015042 2:171805028-171805050 CATTAAATGGGGGAGTTGTATGG + Intronic
942953734 2:181750620-181750642 CACAAAACTGGGCGGCTGTTTGG - Intergenic
943240418 2:185377109-185377131 CACAAAACTGGGCAGCTGTTTGG - Intergenic
943477187 2:188371836-188371858 CACAACATTGAGCAGGTGTTTGG + Intronic
943599169 2:189893301-189893323 CACAAAACTGGGCGGCTGTTTGG - Intronic
943660445 2:190554213-190554235 CACAAAACTGGGCAGCTGTTTGG + Intergenic
944292000 2:198018289-198018311 CACAAAACTGGGCGGCTGTTTGG + Intronic
945210927 2:207381269-207381291 CACAAAACTGGGCAGCTGTGTGG - Intergenic
947033466 2:225824598-225824620 CACAAAACTGGGCGGCTGTTTGG + Intergenic
1169320088 20:4625405-4625427 GACAAAACTGGGCAGCTGTTTGG - Intergenic
1170167940 20:13381158-13381180 CACAAAACTGGGCGGCTGTTTGG - Intergenic
1170727377 20:18941939-18941961 CACAAAACTGGGCAGTCATTTGG - Intergenic
1170899397 20:20446236-20446258 CTCAAAATGGGGAAGTTGAGAGG - Intronic
1172883178 20:38214718-38214740 CACAAAATGAGGCAGAGGCTCGG - Intronic
1173562097 20:44013269-44013291 AAGAAAATGGGGGAGGTGTTAGG - Intronic
1174429522 20:50457893-50457915 CACAAACTGGGGCAGGGGGTGGG + Intergenic
1174887381 20:54350582-54350604 CACAAAATGGTGGTGTTGCTAGG + Intergenic
1175040918 20:56049914-56049936 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1175333176 20:58178506-58178528 CACAATATGGGGCTGTTGCAAGG + Intergenic
1177517885 21:22177981-22178003 CACAAAACTGGGCAGTTGTTTGG + Intergenic
1178465858 21:32847079-32847101 TACAAAATGGGGCATTTGTGTGG - Intergenic
1180596197 22:16975066-16975088 CACAAAACTGGGCAGCTTTTTGG + Intronic
1182969848 22:34563536-34563558 CACAAAAAAGGGCAGTTTTATGG + Intergenic
1183021528 22:35031028-35031050 CACAAAACTGGGCGGCTGTTTGG - Intergenic
949154968 3:816557-816579 CACAAAACTGGGTGGTTGTTTGG + Intergenic
950161376 3:10763680-10763702 CTGAAAATGAGGCAGTTGTGGGG - Intergenic
951687633 3:25362554-25362576 CACAAAACTGGGCAGCTTTTGGG - Intronic
952098643 3:29985430-29985452 CACAAAACCGGGCAGCTATTTGG - Intronic
952475848 3:33709816-33709838 CACAACATGTGGCTGTTATTTGG + Intronic
953555820 3:43946140-43946162 CACAAAACTGGGCAGCCGTTTGG - Intergenic
953869921 3:46617710-46617732 CACTAAATGGGGCAGGGGTGGGG + Intronic
954510531 3:51121074-51121096 CACAAAACTGGGCGGCTGTTTGG - Intronic
954950495 3:54468489-54468511 CACAAAATGGGGCAGCCGTTTGG + Intronic
954991884 3:54848424-54848446 CAGAATATGGGGCATTTGTTTGG - Intronic
955175826 3:56612374-56612396 CACCAAATGGACCAGTCGTTAGG + Intronic
955439720 3:58942632-58942654 CAAAAAACAGGGCAGCTGTTTGG + Intronic
955447769 3:59032255-59032277 CCCAAAACTGGGCAGCTGTTTGG + Intronic
955454007 3:59100606-59100628 CACAAAACTGGGTAGCTGTTTGG - Intergenic
956242171 3:67142504-67142526 CACAAAACTGGGCAGCTGTTAGG - Intergenic
957474808 3:80709487-80709509 CACAAAACTGGGCAGCCGTTTGG + Intergenic
958694606 3:97511263-97511285 CACAAAACTGGGCAGCTGTCTGG - Intronic
959091843 3:101911467-101911489 CACAAAACTGGGCAGCCGTTTGG - Intergenic
959093108 3:101925121-101925143 CACAAAACTGGGCAGCTGTTTGG - Intergenic
959534573 3:107470416-107470438 CACAAAACTGGGCAGCTGTTTGG + Intergenic
959800960 3:110495067-110495089 CACAAAACTGGGCGGCTGTTTGG + Intergenic
960378160 3:116928369-116928391 CACAAAACTGGGCAGCTGTTTGG - Intronic
960827851 3:121811325-121811347 CACAAAACTGGTCAGCTGTTTGG + Intronic
961195642 3:124999094-124999116 CACAAAAGGGGGCAGATTTCAGG - Intronic
961679477 3:128589518-128589540 CAGAATATGGGGGAGTTTTTAGG - Intergenic
962064347 3:131963298-131963320 CACAAAACTAGGCAGCTGTTTGG + Intronic
962156813 3:132956761-132956783 CACAAAACTGGGCGGTTGTTTGG + Intergenic
963014003 3:140803368-140803390 CACAAAACTGGGCGGCTGTTTGG - Intergenic
963976286 3:151483859-151483881 CACAAAACTGAGCAGCTGTTTGG + Intergenic
964010331 3:151885200-151885222 CACAAAACCGGGCATTCGTTTGG + Intergenic
964232443 3:154486840-154486862 CACAAAACTGGGCAGCTATTTGG + Intergenic
965091101 3:164163494-164163516 CACAAAACTGAGCAGCTGTTTGG - Intergenic
965618765 3:170621738-170621760 CACAAAACTGGGCAGCCGTTTGG - Intronic
966657525 3:182376268-182376290 TAGAAAATGGAACAGTTGTTAGG - Intergenic
967562700 3:190935106-190935128 CACAAAACTGGGCAGCCGTTTGG - Intergenic
970304684 4:14718998-14719020 CACAAAACTGGGCAGCCGTTTGG + Intergenic
971340296 4:25762598-25762620 CAGAATATGGGGCAGCTATTAGG + Intronic
971650002 4:29259240-29259262 CACAAAATGGAGCAACTGTGGGG - Intergenic
972372497 4:38438295-38438317 CATAAAACTGGGCAGCTGTTTGG - Intergenic
972962704 4:44473769-44473791 CACAAAACTGGGCGGCTGTTTGG + Intergenic
973321748 4:48817317-48817339 CACAAAACTGGGCGGCTGTTTGG + Intronic
973629066 4:52801996-52802018 CACCAAACTGGGCAGCTGTTTGG + Intergenic
974251813 4:59394586-59394608 CACAAAATGGGGCAGCTGTTTGG - Intergenic
974298444 4:60034600-60034622 CACAAAACAAGGCAGCTGTTTGG - Intergenic
974307130 4:60156478-60156500 CACAAAATTGGGCAGCCATTTGG - Intergenic
974792962 4:66713950-66713972 CACAAAACTGGGCAGCTGTTTGG + Intergenic
975177866 4:71308767-71308789 CACAAAACTGGGCTGCTGTTTGG + Intronic
975213007 4:71722767-71722789 AACAAAACTGGGCAGCTGTTTGG - Intergenic
975305631 4:72846319-72846341 CACAAAACTGGGCGGCTGTTTGG + Intergenic
975307567 4:72866845-72866867 CACAAAACTGGGCAGCTGTTGGG + Intergenic
975425007 4:74215278-74215300 CACAAAATTGGGTGGCTGTTTGG - Intronic
975479304 4:74859910-74859932 CACAAAACTGGGCAGCTGTTTGG + Intergenic
975620366 4:76290702-76290724 CACAAAACTGGCCAGCTGTTTGG - Intronic
975638749 4:76478034-76478056 CACAAAACTGGGCGGTTGTTTGG + Intronic
975764643 4:77654797-77654819 CACAAAACCGGGCAGCTGTTTGG + Intergenic
976023878 4:80664172-80664194 CACAAAACTGGGCGGCTGTTTGG + Intronic
976809969 4:89090113-89090135 CACAAAACTGGGCAGCTGTTTGG - Intronic
977095425 4:92736718-92736740 CATAAACTGGGGCAGTGTTTAGG - Intronic
977185690 4:93932880-93932902 CACAAAACTGGGCAGTCATTTGG - Intergenic
977500232 4:97828446-97828468 CACAAAACTGGGCAGCTGGTTGG + Intronic
977587568 4:98791153-98791175 CACAAAATGTGGAACATGTTTGG - Intergenic
977792899 4:101128805-101128827 CACAAAACTGGGCGGCTGTTTGG + Intronic
977887845 4:102273003-102273025 CACAAAACTGGGTGGTTGTTTGG + Intronic
978090252 4:104706903-104706925 CACAAAACTGGGCGGCTGTTTGG + Intergenic
978100241 4:104830016-104830038 CACAAACTGAGACAGTTGCTGGG + Intergenic
978108234 4:104930618-104930640 CACAAAACTGGGCAGTCATTTGG + Intergenic
978179570 4:105776420-105776442 CACAAAACTGGGCGGCTGTTTGG - Intronic
978664259 4:111164087-111164109 CACAAAACTAGGCAGCTGTTTGG + Intergenic
979119796 4:116883438-116883460 CATAAAACTGGGCAGATGTTTGG - Intergenic
979215134 4:118154247-118154269 CACACTGTGGGGCAGGTGTTAGG - Intronic
979391991 4:120138779-120138801 CAGAAGATGGGGAACTTGTTGGG - Intergenic
979998749 4:127464239-127464261 CACAAAACTGGGTAGCTGTTTGG - Intergenic
980082859 4:128362809-128362831 CCTAAATTGGGGCAGTTGTGAGG + Intergenic
980855192 4:138431485-138431507 CACAAAACTGGGCAGCTGTTTGG + Intergenic
980888178 4:138785821-138785843 CACAAAACTGGGCAGCCGTTTGG - Intergenic
981134024 4:141189980-141190002 CACAAAACCAGGCAGCTGTTTGG - Intronic
981254653 4:142647522-142647544 CACACAATTGGGCAGGCGTTAGG - Intronic
981629661 4:146804291-146804313 CACAAAACAGGGCGGCTGTTTGG + Intronic
981749824 4:148082621-148082643 CACAAAACTGGGCACTGGTTAGG + Intronic
982393584 4:154892044-154892066 CACAAAACTGGGCAGCTGTTTGG + Intergenic
982555525 4:156857874-156857896 CACAAAAGTGGGCAGATGTACGG + Intronic
982852996 4:160342559-160342581 CACAAAACTGGGCAGCTGTTTGG - Intergenic
983169626 4:164521111-164521133 CACAAAACTGGGCAGCTGTTTGG - Intergenic
983485936 4:168331446-168331468 CACAAAATGGGGTGGCTGTTTGG - Intergenic
984493636 4:180468457-180468479 CACAAAACTGGGCAGCCGTTTGG + Intergenic
984618600 4:181927070-181927092 CACAAAACCAGGCAGCTGTTTGG + Intergenic
984719161 4:182954089-182954111 CACACAATGCTGCAGTTATTAGG + Intergenic
984831445 4:183978812-183978834 CACAACATGAAGCAGTTCTTTGG + Intronic
984902907 4:184600751-184600773 CACAAAACTGGGCAGCCGTTTGG + Intergenic
985194056 4:187408514-187408536 CACAAAACTGGGCAGCCGTTTGG - Intergenic
985244628 4:187967849-187967871 CAGAAAATGGGGGAGTGTTTGGG - Intergenic
985317373 4:188672532-188672554 CACAAAACTGGACAGCTGTTTGG + Intergenic
988783094 5:34541416-34541438 CTCAAAATGGGGCAGCCCTTGGG + Intergenic
989363901 5:40634518-40634540 CACAAAACTGGGCTGCTGTTTGG + Intergenic
989794326 5:45447792-45447814 CTCAAAAAGGGGGAGGTGTTTGG + Intronic
990098821 5:52156699-52156721 CACAAAACTGGGCAGCCGTTTGG + Intergenic
990479061 5:56189907-56189929 TACAAAATGGTGCAGCCGTTTGG - Intronic
990745894 5:58959169-58959191 CACAAAACTGGGCAGCTGTTTGG - Intergenic
991110780 5:62896933-62896955 CAAAAAACTGGGCAGCTGTTTGG - Intergenic
991901106 5:71461459-71461481 CACAAAATTAGCCAGGTGTTAGG + Intronic
992976938 5:82130427-82130449 CACAAAACTGGGCAGTCATTTGG - Intronic
993673918 5:90795039-90795061 CACAAAACTGGGCAGCTGTTTGG + Intronic
993911513 5:93690111-93690133 CACAAAACTGGGCGGCTGTTTGG + Intronic
994015008 5:94955324-94955346 CACAAAACTGGGCAGTCATTTGG + Intronic
996129903 5:119769585-119769607 CACAAAACTGGGCAGCTATTTGG + Intergenic
996426659 5:123320411-123320433 CACAAAAGTGGGCAGCTGCTTGG - Intergenic
997143437 5:131407112-131407134 CATAAAATGGGGGATTTGTAAGG - Intergenic
998069317 5:139184370-139184392 CATAAAATGGGGGTGTTGTGTGG + Intronic
998252788 5:140563998-140564020 CCCAAAATGGGTCAGTTCTTAGG + Intronic
999468629 5:151831207-151831229 CACAAAACTGGGCAGCTGTTTGG + Intronic
999502421 5:152160389-152160411 CACAAAACTGGGCAGCTGTTTGG - Intergenic
999602555 5:153282912-153282934 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1000157600 5:158567231-158567253 CACAGACTGAGGCAGTTGTTTGG + Intergenic
1000660484 5:163932849-163932871 CACAAAATTGGGCGGCTATTTGG + Intergenic
1002673497 5:180889755-180889777 CACAAAACTTGGCAGGTGTTTGG + Intergenic
1002734844 5:181377652-181377674 CACAAAACTAGGCAGCTGTTTGG - Intergenic
1002749683 6:96470-96492 CACAAAACTAGGCAGCTGTTTGG + Intergenic
1002996078 6:2286577-2286599 CACAAAACTGGGCAGCTATTTGG + Intergenic
1004027956 6:11837247-11837269 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1007858097 6:44878983-44879005 CACAAAACTGGGCAGCTGTTTGG + Intronic
1008407635 6:51136521-51136543 CATAAAACTGGGCAGCTGTTTGG - Intergenic
1008492417 6:52100232-52100254 TACCTAATGGGGCAGTTGTAAGG - Intergenic
1009281553 6:61758171-61758193 CACAAACTGGGGAAATTGTAGGG + Intronic
1009336022 6:62492077-62492099 CACAAAACTGGGCCGTTGTTTGG + Intergenic
1009455229 6:63848741-63848763 CACAAAACTGGGCAGCTGTTTGG + Intronic
1009458721 6:63887715-63887737 CACAAAACTGGGCAGCCGTTTGG + Intronic
1009740282 6:67734647-67734669 CACAAAACTGGGCGGCTGTTTGG - Intergenic
1009959549 6:70501575-70501597 CACAAAACTGGGCAGCTGTTTGG - Intronic
1010309444 6:74366767-74366789 TACAAAATTGGGCTGATGTTTGG - Intergenic
1010800100 6:80165432-80165454 CGAAACATGGGGCAGGTGTTGGG - Intronic
1011385306 6:86790630-86790652 CTCAAAATGGTGCAGGTATTTGG - Intergenic
1011766231 6:90623171-90623193 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1012163809 6:95923416-95923438 CACAAAATGACACAGATGTTGGG - Intergenic
1012207508 6:96478977-96478999 CACAGAACTGGGCAGTCGTTTGG - Intergenic
1012302919 6:97612424-97612446 CACAAAACGGGGCGGCTGTTTGG - Intergenic
1012597155 6:101054231-101054253 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1012624587 6:101391729-101391751 GACAGAATGGGGCATTTTTTCGG + Intergenic
1012922457 6:105234085-105234107 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1013037955 6:106404940-106404962 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1013452955 6:110303220-110303242 CACAAAATTGGGCAGCCATTTGG + Intronic
1013672586 6:112421439-112421461 CACAAAACCGGGCAGCTATTTGG + Intergenic
1013972869 6:116041805-116041827 CACAAAACTGGGCAGCCGTTTGG + Intronic
1014099511 6:117495266-117495288 CACTAAATGGGGGATTTCTTAGG + Intronic
1014113350 6:117645669-117645691 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1014129129 6:117811079-117811101 CACAAAACGGGGCAGCTGTTTGG - Intergenic
1014753662 6:125280298-125280320 CACAAAACTGGGCAGCCGTTTGG + Intronic
1014968197 6:127782380-127782402 CACAAAACTGGGCAGCTGTTTGG - Intronic
1015163056 6:130174258-130174280 CACAAAATTGGGTGGCTGTTTGG - Intronic
1015291033 6:131538617-131538639 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1017813315 6:157999669-157999691 CAGAAATTGGGGCAGGTGGTGGG + Intronic
1019203712 6:170341577-170341599 CACAAAACTGGGCAGCTGTTTGG - Intronic
1019239106 6:170649969-170649991 CACAAAACTAGGCAGCTGTTTGG - Intergenic
1019255382 7:46479-46501 CCCAAAATGGGGCAGTGCTGTGG - Intergenic
1019559781 7:1650304-1650326 CAGAAAATGGGGCAGCTACTGGG - Intergenic
1020091954 7:5346682-5346704 CCCAGAATGGGGGAGTTGCTAGG - Intronic
1020535768 7:9395900-9395922 TTTAAAATGGGGCAGTTATTTGG - Intergenic
1020590103 7:10124776-10124798 CACAAAAGTGGGCAGCCGTTTGG - Intergenic
1021014625 7:15517723-15517745 CACAAAATTGGGCGGCAGTTTGG + Intronic
1021749390 7:23779919-23779941 CACAAAACTGGGCAGACGTTTGG - Intronic
1022063855 7:26829807-26829829 CATAAAATGGTGCAGTCATTTGG + Intronic
1023697805 7:42865512-42865534 CACAAAATGGGGTGGCTGTTTGG - Intergenic
1024577339 7:50775345-50775367 GACACAATGGGGCAGGAGTTGGG + Intronic
1024664945 7:51536846-51536868 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1024998563 7:55294995-55295017 CACAAAACTGGGCGGCTGTTTGG - Intergenic
1025245158 7:57311308-57311330 CACAAACTGGGGCAGTGGGTGGG - Intergenic
1025637968 7:63340210-63340232 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1025644728 7:63407889-63407911 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1025714359 7:63941306-63941328 CACAAAACTGGGTAGCTGTTTGG + Intergenic
1026975257 7:74493970-74493992 CCCAAGAGGGGGCAGCTGTTTGG - Intronic
1027195052 7:76024242-76024264 CTCAAAAAGGGGGAGGTGTTGGG + Intronic
1028066720 7:86393072-86393094 AACAAGATGGGGAAGTTGTATGG - Intergenic
1028378070 7:90168194-90168216 CACAAAACTGGGCAGCCGTTTGG + Intronic
1028430002 7:90735908-90735930 CACAAAACTGGGCAGCCGTTTGG - Intronic
1029257573 7:99279836-99279858 GACCACATGGGGCAGTTTTTTGG + Intergenic
1029845294 7:103406260-103406282 CACAAAACTGGGCAGCTATTTGG - Intronic
1030801302 7:113856330-113856352 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1030849855 7:114470544-114470566 CAAAAACTGGGCCAGATGTTGGG - Intronic
1031232272 7:119123436-119123458 CACAGAATGGGGGATGTGTTGGG - Intergenic
1031397773 7:121293589-121293611 CACAAAATGGGGCAGCCATTTGG - Intronic
1032702204 7:134392157-134392179 CACAAATTGGGGGAGTTGAGAGG - Intergenic
1033366248 7:140674055-140674077 CACATACTGGGGCAGTCGGTGGG + Exonic
1034562823 7:151892546-151892568 CACAAAATGGGCCAGGTGTGGGG + Intergenic
1035508666 8:156639-156661 CACAAAACTAGGCAGCTGTTTGG + Intergenic
1036582577 8:10089319-10089341 TACAAAAGGAGGCAATTGTTAGG - Intronic
1037205307 8:16310711-16310733 CACAAAATGGGTAAATTCTTTGG - Intronic
1039740820 8:40381035-40381057 CACATAAAGGGGCAGGTGTAGGG - Intergenic
1040095962 8:43442940-43442962 CATAAACTGGGGCTGTTGCTGGG + Intergenic
1040520132 8:48169467-48169489 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1041459784 8:58098626-58098648 CACAAAACTGGGCAGCCGTTTGG - Intronic
1042622753 8:70724472-70724494 CACAAAACTGGGCAGCTATTTGG - Intronic
1043036713 8:75208422-75208444 CACAAAACTAGGCAGCTGTTTGG - Intergenic
1043253705 8:78106675-78106697 CACAAAACTGGGCGGTAGTTTGG - Intergenic
1043532394 8:81165723-81165745 CACAAAACTGGGTGGTTGTTAGG + Intergenic
1043703576 8:83321830-83321852 CACAAAACTGGGTAGCTGTTTGG + Intergenic
1045199626 8:99967282-99967304 CACAAAACTGGGCAGCTGTTTGG + Intronic
1046014587 8:108590099-108590121 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1047121261 8:121907977-121907999 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1047474182 8:125210611-125210633 AACAAAATGAGGCAATTTTTAGG - Intronic
1048630141 8:136233744-136233766 CACAAAAATGGGCAGCTGTTTGG - Intergenic
1049400049 8:142421458-142421480 CTCAAGATGGCACAGTTGTTAGG + Intergenic
1050034591 9:1422078-1422100 CACACACTGGGTCTGTTGTTGGG - Intergenic
1050055112 9:1644460-1644482 AACAAAATGGGGCACATGATGGG - Intergenic
1050391910 9:5153097-5153119 CACAAAACTGGCCAGCTGTTTGG + Intronic
1050963297 9:11765611-11765633 CACAAAACTGGGCGGCTGTTGGG + Intergenic
1051298153 9:15618598-15618620 CACAAAACTGGGCGGCTGTTTGG - Intronic
1051611687 9:18967829-18967851 AACAAAACTGGGCAGTTGTTTGG - Intronic
1052134044 9:24888804-24888826 CACAAAACTGAGCAGCTGTTCGG + Intergenic
1052146937 9:25061414-25061436 CACAAAATTGGGCAGGTGTTTGG - Intergenic
1052241332 9:26277462-26277484 CACAAAACTGGGCAGCCGTTTGG + Intergenic
1052336436 9:27324695-27324717 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1053037521 9:34838045-34838067 CACAATATGGGGGATTTTTTTGG - Intergenic
1055571734 9:77623826-77623848 CACAAAACTGGGCTGCTGTTTGG + Intronic
1055823925 9:80301364-80301386 CACAAAACTGGGCAGCTTTTTGG - Intergenic
1056235577 9:84590586-84590608 TATAAAATGGAGCATTTGTTTGG + Intergenic
1057719110 9:97518081-97518103 GAGAAGATGGGGCAGGTGTTGGG - Intronic
1058072918 9:100619693-100619715 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1059088810 9:111334356-111334378 CACAAAACTGGGCGGCTGTTTGG + Intergenic
1060409165 9:123388898-123388920 CACAGAATGGGGCAGGGGTGTGG - Intronic
1062725027 9:138067935-138067957 AACAGAATGTGCCAGTTGTTAGG + Intronic
1062759311 9:138330260-138330282 CACAAAACTAGGCAGCTGTTTGG - Intergenic
1203755166 Un_GL000218v1:119180-119202 CACAAAATGGGGCATTTCCCTGG - Intergenic
1203599761 Un_KI270748v1:1032-1054 CACAAAACTAGGCAGCTGTTTGG - Intergenic
1186181355 X:6976283-6976305 CACAAAACTGGGCAGCCGTTTGG - Intergenic
1186636781 X:11414427-11414449 CACAAAAGCAGGCAGTTGTCTGG + Intronic
1186832470 X:13404327-13404349 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1188561279 X:31471232-31471254 CACAAAATTGGGCAGCTGTTTGG - Intronic
1188915494 X:35904961-35904983 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1189039799 X:37530541-37530563 CACAAAATTGGGCAGCTGTTTGG - Intronic
1189210844 X:39280786-39280808 CACAAAACTGGGCAGGCGTTTGG - Intergenic
1189590609 X:42507083-42507105 CACAAAACTGGGCAGCTATTTGG + Intergenic
1189754099 X:44253190-44253212 CACAAAACTGGGCAGCTGTTTGG + Intronic
1189937723 X:46087184-46087206 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1190495125 X:51021147-51021169 CACAAAACTGGGCAGCTATTTGG - Intergenic
1190944011 X:55073154-55073176 CACAAAACTGGGCAGTTGTTCGG - Intergenic
1190966456 X:55305800-55305822 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1191094387 X:56659229-56659251 CACAAAACTGGGCGGCTGTTTGG - Intergenic
1191097469 X:56688692-56688714 CACAAAACTGGGCAGCTTTTTGG - Intergenic
1191115369 X:56846780-56846802 CACAAAATTTGGCAGCTGTTTGG + Intergenic
1191119707 X:56890681-56890703 CACAAAACTGGCCAGCTGTTTGG + Intergenic
1191132663 X:57031104-57031126 CACAAAACTGGGCGGCTGTTTGG - Intergenic
1191148140 X:57190489-57190511 CACAAAACTGGGCGGCTGTTTGG - Intergenic
1191631915 X:63331084-63331106 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1191799955 X:65067224-65067246 CACAAAATGGGGCAGCTGTTTGG - Intergenic
1191802674 X:65098790-65098812 CACAAAATGGGGCAGCTGTTTGG + Intergenic
1191969630 X:66799094-66799116 AACAAAATTGGGCAGCTGTTTGG + Intergenic
1192524512 X:71830023-71830045 CACAAAACTGGGCAGCCGTTTGG + Intergenic
1192707375 X:73540945-73540967 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1192759231 X:74078147-74078169 CACAAAACTGGGCGGCTGTTTGG - Intergenic
1192953213 X:76039697-76039719 CACAAAACTGGGCAGTTGTTTGG - Intergenic
1192993987 X:76492714-76492736 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1192998061 X:76533496-76533518 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1193071847 X:77314727-77314749 CACAAAACTGGGCAGCTGTTCGG + Intergenic
1193404439 X:81083981-81084003 CACAAAACTGGGCTGCTGTTTGG + Intergenic
1193438229 X:81506531-81506553 CACAAAATGGTGACTTTGTTGGG + Intergenic
1193514351 X:82445646-82445668 CACAAAACTGGGCAGCTGTTGGG + Intergenic
1193571635 X:83151733-83151755 CACAAAATTAAGCAGCTGTTTGG + Intergenic
1194609796 X:96028582-96028604 CACGAAATGGGATAGATGTTTGG + Intergenic
1194624743 X:96214565-96214587 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1194708084 X:97200248-97200270 CACAAAACTGGGCAGCTGTTTGG + Intronic
1194754324 X:97719817-97719839 TACAAAATGGGGCAGTTGGCTGG + Intergenic
1195102258 X:101566911-101566933 CACAAAACTGGGCAGCCGTTTGG + Intergenic
1195434727 X:104829212-104829234 CACAAAATTGGGCAGCCATTTGG - Intronic
1195468999 X:105212022-105212044 CACAAAACTGGGCAGCTGTTTGG + Intronic
1195730317 X:107960009-107960031 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1195820913 X:108944462-108944484 CACAAAACTGGGCAGCTGTTTGG - Intergenic
1195842715 X:109192066-109192088 CAGAAAACTGGGCAGCTGTTTGG + Intergenic
1196960249 X:120993133-120993155 CACAAAACTGGGCGGCTGTTTGG - Intergenic
1197184705 X:123573552-123573574 CACAAAACTGGGCGGCTGTTCGG + Intergenic
1197395637 X:125923419-125923441 CACAAAATTGGGCAGCTGTTTGG - Intergenic
1197403714 X:126025649-126025671 CACAAAACTGGGCTGCTGTTTGG + Intergenic
1197880788 X:131164507-131164529 CATAAAACTGGGCAGCTGTTTGG - Intergenic
1198002311 X:132451751-132451773 CACAAAACTGGGCAGCCGTTTGG - Intronic
1198085599 X:133279050-133279072 CACAAAACTGGGCAGCTGTTTGG + Intergenic
1198295425 X:135282570-135282592 CACAAAACTGGGCAGCTATTTGG - Intronic
1198757976 X:140000954-140000976 AACAAAACTGGGCAGCTGTTTGG + Intergenic
1199094437 X:143723532-143723554 CACAAAACTGGGCAGCCGTTTGG + Intergenic
1199801174 X:151252774-151252796 CACAAAACTGGGCGGCTGTTTGG + Intergenic
1200365453 X:155657701-155657723 CACAAAACTGGGCGGCTGTTCGG - Intronic
1200666274 Y:6029102-6029124 CACAATATGTGGCAGTTGGAAGG - Intergenic
1201462237 Y:14239350-14239372 CACAAAACTGGGCAGCTGTTTGG + Intergenic