ID: 1079816168

View in Genome Browser
Species Human (GRCh38)
Location 11:25061476-25061498
Sequence GATCTAAGGAGAAACACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079816168_1079816171 -4 Left 1079816168 11:25061476-25061498 CCAGCTGTGTTTCTCCTTAGATC 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1079816171 11:25061495-25061517 GATCTCCTGTATAATTGAATGGG 0: 1
1: 0
2: 0
3: 9
4: 101
1079816168_1079816170 -5 Left 1079816168 11:25061476-25061498 CCAGCTGTGTTTCTCCTTAGATC 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1079816170 11:25061494-25061516 AGATCTCCTGTATAATTGAATGG 0: 1
1: 0
2: 1
3: 12
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079816168 Original CRISPR GATCTAAGGAGAAACACAGC TGG (reversed) Intronic
900102678 1:968654-968676 GTGCTAAGGAGAAAAACAGAGGG + Intronic
904414649 1:30351635-30351657 GATCTAAAGAAAATCACATCTGG - Intergenic
904932903 1:34104589-34104611 GCCCTAAGAGGAAACACAGCGGG + Intronic
905494986 1:38377906-38377928 GACCTAAAGAGACAAACAGCTGG - Intergenic
908809576 1:67966226-67966248 GATCTAAGTAGAGACATTGCAGG - Intergenic
909219370 1:72935643-72935665 GATAAAAGGAGAAACAAAGGAGG - Intergenic
910604145 1:89065159-89065181 GAACTAAGGAGAAAAAGAACAGG - Exonic
910635934 1:89407737-89407759 GAACTAAGGAGAAAAAGAACAGG + Intergenic
912484016 1:110009686-110009708 GAACTAAAAAGAAACAGAGCTGG - Intronic
918932090 1:190867310-190867332 GATCTGAGGAGAATCACATTTGG - Intergenic
921181385 1:212634391-212634413 AATCTAGGCACAAACACAGCAGG + Intergenic
922214401 1:223508793-223508815 GACCTGAGGAAGAACACAGCTGG - Intergenic
924086537 1:240457548-240457570 GCTCCAAGGAAAAACAGAGCAGG + Intronic
924640544 1:245829324-245829346 GATATAAGATTAAACACAGCAGG + Intronic
1064132807 10:12725062-12725084 CGGCTAAGGAGAAACACAGTGGG - Intronic
1069511411 10:69045402-69045424 TAGCTCAGGAGAAACACACCTGG + Intergenic
1071849827 10:89557763-89557785 GTGCTATGGGGAAACACAGCAGG + Intergenic
1074429079 10:113377985-113378007 GAGCAAAGGAGAATCAAAGCTGG + Intergenic
1076382689 10:130036228-130036250 GAACTAGGGAGTGACACAGCTGG + Intergenic
1076658931 10:132042501-132042523 GATGAAAAGAGAAACACAGCAGG - Intergenic
1078026998 11:7705608-7705630 GAATCAAGGAGACACACAGCTGG + Intronic
1079762451 11:24346646-24346668 TATCTAGGGAGAAATAAAGCTGG - Intergenic
1079816168 11:25061476-25061498 GATCTAAGGAGAAACACAGCTGG - Intronic
1079845122 11:25456507-25456529 GACCTAGGGAGGAGCACAGCTGG - Intergenic
1080760909 11:35247959-35247981 GATATAAGGAGAAACCCAGAAGG + Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1082261492 11:50078937-50078959 GATGTAAGGAGCCACACAGCAGG - Intergenic
1082616339 11:55364993-55365015 GAGCTATGGAGAAAGACAGATGG - Intergenic
1082626161 11:55488806-55488828 GAGCTACGAAGAAAGACAGCTGG - Intergenic
1083939765 11:65889309-65889331 GAGCTAAGCAGAAAGACGGCTGG - Intergenic
1084906145 11:72349428-72349450 TATCCAAGGAAGAACACAGCAGG - Intronic
1085064352 11:73479526-73479548 AATCTGAGGGAAAACACAGCAGG + Intronic
1087021073 11:93603907-93603929 TCCCTAAAGAGAAACACAGCAGG - Intergenic
1089610838 11:119667677-119667699 GAGAAAAGGAGCAACACAGCTGG - Intronic
1092296628 12:7204526-7204548 GATATAAGGGAAAAGACAGCTGG + Intronic
1094526166 12:31232608-31232630 GATTTAAGGAGATACGCAGGTGG - Intergenic
1095211509 12:39500235-39500257 GATCTAAGAATAAACAAAGGTGG - Intergenic
1097465429 12:59918275-59918297 AATCTCAGTAAAAACACAGCAGG - Intergenic
1097985085 12:65774608-65774630 TACCTAAAGAGAAACACACCAGG - Intergenic
1098041040 12:66354241-66354263 CATCTAAGGCCAACCACAGCTGG + Intronic
1101200428 12:102429977-102429999 GACCTAATGTGACACACAGCTGG + Intronic
1101835097 12:108289456-108289478 ACTCTAAGGAGGAAAACAGCCGG + Exonic
1103133671 12:118489471-118489493 GATCTTAGGAGTGACAGAGCAGG - Intergenic
1103665865 12:122565193-122565215 GATGTAAGGAGAAAAACAAAAGG - Intronic
1104575794 12:129964896-129964918 GATCCATGGTGAAACACAGGGGG + Intergenic
1110061294 13:71041086-71041108 GACCTAAGGAGAGGCACAGTTGG - Intergenic
1111221707 13:85213439-85213461 GATCTAAGGAAAATTATAGCCGG - Intergenic
1111752239 13:92347339-92347361 TTTCTCAGGAGAAACACTGCAGG + Intronic
1114491474 14:23104924-23104946 TATCTACGGAGAGACACAGAAGG - Intergenic
1116055109 14:39854179-39854201 GACCTAAGGAGAAAGCCATCTGG + Intergenic
1116518163 14:45823411-45823433 GATATTAGGAGCAACACAACAGG - Intergenic
1117275992 14:54194135-54194157 GATCAAAGTAAAAACACAGAGGG - Intergenic
1119688189 14:76649886-76649908 GAACTATTAAGAAACACAGCAGG - Intergenic
1119704801 14:76776851-76776873 GAGCTATGGAGATACCCAGCAGG - Intronic
1121036898 14:90713559-90713581 GAGCTAAAGAGAAAAAAAGCTGG + Intronic
1121111182 14:91314148-91314170 GATCTACGGGAAAACACAACAGG + Exonic
1122754861 14:103970315-103970337 GCCCTAAGGAGAAACACTGGGGG + Intronic
1127385378 15:58462591-58462613 TATCTAAGTGGAAACAGAGCAGG - Intronic
1129519932 15:76179171-76179193 GTTCTAAAGAGAGACACACCTGG - Intronic
1130732119 15:86507128-86507150 GATCCAAGGAGAAAATCAGAGGG - Intronic
1132717547 16:1299458-1299480 CATCGAAGGAGAAACCCTGCTGG - Intergenic
1133018789 16:2956855-2956877 GATGTAGGGAGAAGCACATCAGG + Intergenic
1133069070 16:3233926-3233948 GATCTAAAGAAAACGACAGCTGG + Intronic
1133538614 16:6725852-6725874 AATCAAATGAGAAACACTGCTGG - Intronic
1133593011 16:7264350-7264372 GATCTTATGAGAAACTCAGAAGG + Intronic
1133685733 16:8163754-8163776 CAGCTAAAGAAAAACACAGCTGG - Intergenic
1133934741 16:10259526-10259548 GAAGTAAAGAGAAAAACAGCTGG - Intergenic
1134850767 16:17476875-17476897 GATTTCAGCAGAAGCACAGCTGG - Intergenic
1135459378 16:22628232-22628254 GATCTTAGTAGAATCACAGGTGG + Intergenic
1137047813 16:35685065-35685087 GGTCTAAGGATAGACACACCTGG - Intergenic
1137373606 16:47932040-47932062 GAGCAGAGGAGAAACACAGTAGG - Intergenic
1137634358 16:49973210-49973232 GCTCTAAGGAGGAACGCTGCAGG + Intergenic
1137959446 16:52867076-52867098 GACCTAAGGAGAAAAACATATGG + Intergenic
1142476099 17:191171-191193 GGTCTAAGGAAAACCCCAGCTGG + Intergenic
1142931584 17:3289521-3289543 GATCTTTGGAGATAAACAGCAGG + Intergenic
1143130813 17:4675882-4675904 GAGCTAAAGAGAATCAGAGCAGG + Exonic
1144182099 17:12762043-12762065 GTTTTCTGGAGAAACACAGCTGG + Intronic
1144254718 17:13456117-13456139 GATCTAAGGAGAAAGGTTGCAGG + Intergenic
1147212609 17:38880629-38880651 CAGCTAAAGTGAAACACAGCTGG - Intronic
1150113775 17:62526303-62526325 GAACTAAGTAGAAATACAGTAGG - Intronic
1152892327 17:82889640-82889662 GAGCAAAGAACAAACACAGCAGG - Intronic
1153346903 18:4036190-4036212 AATACTAGGAGAAACACAGCTGG + Intronic
1153692683 18:7609194-7609216 AATCTCAGGAGAAAGACAGACGG - Intronic
1154381224 18:13851870-13851892 GATCTCATGAGAAACACTGGTGG + Intergenic
1157793054 18:50549890-50549912 GATCTGAGGTGATACACAGAAGG + Intergenic
1159180643 18:64898432-64898454 GTCCTAGGAAGAAACACAGCAGG + Intergenic
1160497670 18:79384640-79384662 GATCCATGGAGACAGACAGCAGG + Intergenic
1164431426 19:28192448-28192470 GACCTAGTGAGAAAAACAGCTGG - Intergenic
1167885091 19:52493517-52493539 AACCGAGGGAGAAACACAGCAGG + Intronic
1167889594 19:52528698-52528720 AACCGAGGGAGAAACACAGCAGG + Intronic
1168139861 19:54378532-54378554 AATATAAGAACAAACACAGCCGG + Intergenic
1168543105 19:57229427-57229449 GACCTAAGGAAAAACAGAACAGG + Intergenic
927133809 2:20082164-20082186 TTGCTAAGGAGAAGCACAGCAGG - Intergenic
929246274 2:39707048-39707070 GATTTAAGAAGAATCACTGCTGG + Exonic
932165323 2:69500110-69500132 GATCAAAGGAGAAACTAAGCAGG - Intronic
932214675 2:69959023-69959045 GTTCCCAGGAGAATCACAGCTGG + Intergenic
932592215 2:73074362-73074384 GATCCCAGGATAAACACTGCTGG - Exonic
934756562 2:96828408-96828430 GAGAGAAGGACAAACACAGCCGG - Intronic
938026531 2:127953838-127953860 GTTCTATGGAGAAACAAAGCAGG - Intronic
940893241 2:159055631-159055653 GATCAAAGAACAAACACAGTCGG - Intronic
942303697 2:174586278-174586300 GATCTAAGCGAAAACAGAGCGGG + Intronic
942413065 2:175731823-175731845 GATTGAGGGAGAAAAACAGCTGG - Intergenic
943809755 2:192170018-192170040 TAATTAAAGAGAAACACAGCTGG - Intronic
947759601 2:232594083-232594105 CAACTAAGCAGAAACAGAGCCGG - Intergenic
948171677 2:235908488-235908510 GATGTAAGGAGAGACACAGCAGG - Intronic
1168989135 20:2079367-2079389 GAAGTAAGGAGAATGACAGCGGG - Intergenic
1169390438 20:5186287-5186309 GATCTCAGGAGGAACAAGGCTGG - Intronic
1169741634 20:8901302-8901324 AATCTCAGAAGAAACACAGAGGG - Intronic
1172673029 20:36647428-36647450 GATCAAAGGAGAACCTGAGCAGG - Intergenic
1173646636 20:44637428-44637450 GCTGTTAGGAGAAGCACAGCAGG + Intronic
1176546063 21:8200328-8200350 GATGAAAGGAGACACACAGATGG + Intergenic
1176565014 21:8383373-8383395 GATGAAAGGAGACACACAGATGG + Intergenic
1179546063 21:42112938-42112960 CATCTCAGGAGATTCACAGCAGG + Intronic
1183100961 22:35583751-35583773 GATCTAAGGCCAAACATGGCTGG + Intergenic
1184379481 22:44136170-44136192 GGTCTCAGGAGAAACACCCCAGG - Intronic
1203250935 22_KI270733v1_random:116565-116587 GATGAAAGGAGACACACAGATGG + Intergenic
950555128 3:13690848-13690870 GAGCTCAGGAGAGTCACAGCTGG + Intergenic
953977973 3:47396617-47396639 GATGTAAAGTGAAAGACAGCTGG + Intronic
954377346 3:50202133-50202155 GATCTCAGGAGAGAGACAGCAGG + Intergenic
954379127 3:50210341-50210363 GATCTCAGGAGAGAGACAGCTGG - Intronic
955817230 3:62858053-62858075 GTTCTAAAGAGAAATACAGCAGG + Intronic
956272988 3:67467848-67467870 GATGTAAGAGGAAACAGAGCGGG + Intronic
958510627 3:95042793-95042815 TATCTAAGAAGGAACACACCGGG - Intergenic
958677945 3:97291869-97291891 AATCTAAGCAGAGGCACAGCTGG - Intronic
960157178 3:114307928-114307950 GACCTCAGGAGAAAATCAGCTGG + Exonic
962964687 3:140342632-140342654 GACTTTAGAAGAAACACAGCAGG + Intronic
964011346 3:151895619-151895641 GCTTAAAGGAGAAACTCAGCAGG - Intergenic
967537072 3:190617800-190617822 GAGCTAACCAGACACACAGCAGG + Intronic
968074924 3:195811051-195811073 GATCTGAGGGGAAAGACAGAGGG - Intronic
969249010 4:5955030-5955052 GAGCTCAGGAGGAAGACAGCAGG - Intronic
969431248 4:7155956-7155978 GAACTAGGGAGAAACTGAGCAGG - Intergenic
970415291 4:15850866-15850888 GATCTTAAGAGGAAAACAGCAGG - Exonic
971836670 4:31773831-31773853 GATCTGAGCAGCAACACAGCTGG + Intergenic
974100546 4:57411475-57411497 AAGCTATGAAGAAACACAGCCGG + Intergenic
975496780 4:75044515-75044537 GAGCTAAGAATAAACACAGCAGG + Intronic
976043823 4:80920459-80920481 GACCTAAGGAGAATCAGAGGTGG - Intronic
979258677 4:118630037-118630059 GCTGTAAGGAGCCACACAGCAGG + Intergenic
979531549 4:121773967-121773989 GAGCTAATGGGACACACAGCAGG - Intergenic
979647944 4:123093752-123093774 GATCTAAGGAGCCCAACAGCAGG + Intronic
979715646 4:123834179-123834201 GTTTTATGGATAAACACAGCAGG + Intergenic
979779257 4:124629203-124629225 CTTCTAAGGAGAGACACAGAAGG + Intergenic
979779376 4:124631288-124631310 CTTCTAAGGAGATACACAGAAGG + Intergenic
982230543 4:153204768-153204790 AATCGAGGGAGAGACACAGCTGG + Intronic
982661856 4:158216734-158216756 GAGCTAAAGAGAAAAACAGGAGG + Intronic
987688206 5:21232458-21232480 TATCTAAGGAGTAGCATAGCTGG - Intergenic
987963661 5:24844246-24844268 GAACCAAGGAGAAACACTGATGG - Intergenic
990943637 5:61228655-61228677 GATCTTAAAAGAAGCACAGCAGG + Intergenic
992210633 5:74476367-74476389 GCTCTAAGGAGGAAGCCAGCTGG - Intergenic
993749675 5:91651292-91651314 GATCCAAGAAGAAACACCACAGG + Intergenic
994200568 5:96970361-96970383 GATAAAAGGAGAAATTCAGCAGG - Intronic
994725975 5:103435839-103435861 GATGTAAGAAGCAACACAGCAGG - Intergenic
995112863 5:108446714-108446736 ATTCTCAGGAGAAACAAAGCAGG + Intergenic
996385065 5:122902186-122902208 GAGGTATGGAGAGACACAGCAGG - Intronic
996409203 5:123138797-123138819 GGTCTAAGGAGAGAAGCAGCAGG + Intronic
998894024 5:146778893-146778915 CATCTATGGAAAAACAGAGCCGG + Intronic
999119959 5:149201521-149201543 GAGCTGAGGAGAAAGACAGTGGG + Intronic
1000824349 5:166026041-166026063 GAGCTAGGAACAAACACAGCTGG + Intergenic
1002803000 6:544137-544159 GAAATAAGGAGTAAAACAGCTGG - Intronic
1003355309 6:5363755-5363777 GATGTAAGGAGTAAGACAGAGGG - Intronic
1003750946 6:9055261-9055283 GATCTAAGAAGAAAAACAAATGG + Intergenic
1003936458 6:10979499-10979521 GATCTAACGAGCAACCCACCGGG - Intergenic
1006180518 6:32150968-32150990 GGGGTAAGGGGAAACACAGCCGG + Intronic
1006204807 6:32331210-32331232 GATCTGAGGAAAAACACTGGGGG - Intronic
1007829308 6:44626440-44626462 GAGATGAGGAGAAACACAGTGGG + Intergenic
1008310649 6:49968155-49968177 CATCAAAAGAGAAAAACAGCAGG - Intergenic
1009482472 6:64176242-64176264 AATCAAAGGAGAACCCCAGCAGG + Intronic
1009543741 6:64999655-64999677 GATGTAGTGAGAAACACATCAGG + Intronic
1010615855 6:78011282-78011304 GATCTCACAAGAAACACAACTGG + Intergenic
1011013432 6:82727565-82727587 GATCTGATGAAAAACACATCTGG + Intergenic
1012860152 6:104549874-104549896 GAGTTAAGGAAAAATACAGCAGG - Intergenic
1013376082 6:109515614-109515636 GAGATAAGGAGAAACTCAGGGGG + Intronic
1013545721 6:111155123-111155145 CATCTAAGGTGACACACAGAGGG + Intronic
1015176976 6:130320794-130320816 GATCTATAGTGATACACAGCAGG + Intronic
1020988689 7:15168902-15168924 GCTCTATGGATAAACACAGTTGG + Intergenic
1024033243 7:45483151-45483173 TAAGTAAGGAGAAACAGAGCAGG - Intergenic
1024611497 7:51068326-51068348 GATCTGAGGAGAAAGAAAGCTGG - Intronic
1025183000 7:56833365-56833387 GCTGTAAGGAGCCACACAGCAGG - Intergenic
1025688928 7:63743609-63743631 GCTGTAAGGAGCCACACAGCAGG + Intergenic
1025912141 7:65837789-65837811 GCTGTAAGGAGCCACACAGCAGG + Intergenic
1026172266 7:67964277-67964299 CATCTAATTATAAACACAGCTGG - Intergenic
1031435967 7:121732353-121732375 TATCTTAGAAGAAACCCAGCTGG - Intergenic
1032043479 7:128582062-128582084 GAACTAAGTAGAAATACAGTAGG - Intergenic
1032301550 7:130692004-130692026 GACCAAAGGAGAAACAAAACTGG + Intergenic
1033863989 7:145665372-145665394 AACCTAAGAACAAACACAGCTGG + Intergenic
1036533827 8:9625005-9625027 CATTTAAGGAGAAATACAGTTGG - Intronic
1037349332 8:17933451-17933473 GTTCTAAGGAGAATCCCAGTGGG + Intronic
1038131258 8:24733999-24734021 GAACTAAGGAGAACATCAGCAGG + Intergenic
1039835187 8:41250194-41250216 GTTCTGAGGAGTGACACAGCAGG - Intergenic
1040618258 8:49061690-49061712 GATGTAAGGAGAAAGTCAGATGG + Intronic
1040781829 8:51118594-51118616 GTGCTAAGGAGAAAGACACCTGG + Intergenic
1043046858 8:75336549-75336571 TATTTAAGAAGATACACAGCTGG + Intergenic
1043109735 8:76165647-76165669 GATCTTAGAAGAAACAGAGTAGG - Intergenic
1043308286 8:78824617-78824639 GATCTCAGGGCAAACACAGGAGG - Intergenic
1043378544 8:79677910-79677932 GATCTATAGAGAAACCCAGCTGG + Intergenic
1043579427 8:81695141-81695163 CATCTAAGCAGCAACACAACCGG + Exonic
1046186994 8:110734533-110734555 GCTCTAAGGAGACCCACAGTGGG + Intergenic
1046909256 8:119607759-119607781 GATCTCAGGAAAAAAACACCTGG + Intronic
1047714579 8:127583849-127583871 GATCAAAGGAGAAAACCAGAAGG + Intergenic
1048166437 8:132065675-132065697 GGTCAAGGGAAAAACACAGCAGG - Intronic
1048399435 8:134050498-134050520 GATGGAAGGAGAAACAGAGGGGG + Intergenic
1049560837 8:143309491-143309513 GATCTACAGCAAAACACAGCGGG - Exonic
1050773201 9:9229668-9229690 TATCTTAGGAGAGACAAAGCTGG + Intronic
1050819503 9:9859808-9859830 GTTATAAGGAGAAAGTCAGCTGG - Intronic
1055220767 9:73928104-73928126 GATCTAAGGACACACACAGGTGG + Intergenic
1055585616 9:77756411-77756433 GGACAAAGGAGAAACACATCTGG - Intronic
1055964668 9:81854000-81854022 GGTCTACGAAGAAACACAGCAGG + Intergenic
1056508127 9:87276735-87276757 AAACTATGTAGAAACACAGCCGG + Intergenic
1057978025 9:99627677-99627699 GATTTAAGGAAAAAGACAGTGGG + Intergenic
1058475442 9:105328286-105328308 AGTCTGAGGAGAAACAAAGCAGG + Intronic
1058924822 9:109652782-109652804 AATCTAATGAGAAACATAGTTGG + Intronic
1060426560 9:123511324-123511346 GATCTGAGGGCTAACACAGCGGG + Intronic
1203467337 Un_GL000220v1:99829-99851 GATGAAAGGAGACACACAGATGG + Intergenic
1186060359 X:5698830-5698852 GCTCTCAGGAGAAACTCAGATGG - Intergenic
1187745857 X:22408629-22408651 TTTCTAAGGAGACTCACAGCTGG - Intergenic
1187809751 X:23162475-23162497 GATCTAAGAAGTAAAACAGAAGG + Intergenic
1188988455 X:36789106-36789128 GATGCAATGAGAAAGACAGCTGG - Intergenic
1190935605 X:54996700-54996722 GATCTAAGGAGAGATATGGCTGG - Intronic
1191016406 X:55814065-55814087 GATCTCAGGAGAACCACAGTGGG - Intergenic
1191234714 X:58125024-58125046 GTTCTAAGGATAAAGACACCTGG + Intergenic
1191246382 X:58231617-58231639 ATTCTAAGGATAGACACAGCTGG + Intergenic
1192889098 X:75369110-75369132 GTTCTATGGAGAAGCACAGGGGG - Exonic
1193140551 X:78022264-78022286 GATCTATATAGAAACACAGCTGG - Intronic
1196118263 X:112020462-112020484 GATCTGATGAGGAACACAGAAGG + Intronic
1196860107 X:120019032-120019054 GATATATTGAAAAACACAGCAGG + Intergenic
1198894303 X:141435001-141435023 GGCCTAAGGAGAAACACAACTGG - Intergenic
1200977316 Y:9227074-9227096 GATCTCAGGAGACACAAAGTGGG + Intergenic