ID: 1079816964

View in Genome Browser
Species Human (GRCh38)
Location 11:25073398-25073420
Sequence TCCCTGTGTGGAGGAAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 7, 3: 53, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079816964 Original CRISPR TCCCTGTGTGGAGGAAGTGC TGG Intronic
900188373 1:1343268-1343290 TCCCAGTGTGGGGGAAGCCCTGG - Intronic
900768438 1:4520910-4520932 TCCGTGTATGGTGGAAGTGGAGG - Intergenic
901397225 1:8990136-8990158 TCCCTGGGGAGAGGAAGGGCTGG + Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903540350 1:24093106-24093128 TCCCTGTGGAGGGGAAGTGGGGG + Exonic
905339229 1:37266870-37266892 TGCCTGTGTGGGGGAGGTGGGGG - Intergenic
905473866 1:38212271-38212293 CCCTTGTGTGGTGGAGGTGCCGG + Intergenic
906200860 1:43959331-43959353 TCCCAGTGTAGAGGAAATTCAGG + Intronic
910141319 1:84030293-84030315 TCCCTGTGAGGTTGTAGTGCAGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913538876 1:119799961-119799983 ACGATGTGTGGAGGAAGTGGGGG - Intronic
914927950 1:151905650-151905672 TCCTTTTGTTGAGGGAGTGCTGG - Intronic
915054964 1:153119856-153119878 TCCCTGTGTTGAAAGAGTGCTGG + Intergenic
915089887 1:153416908-153416930 TCCCTCTGTGGGGGCAGAGCTGG - Intronic
915255368 1:154624420-154624442 TCCTTGGGTGGAGGAACTGAGGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
916527883 1:165628825-165628847 TCCCTATGTGGAGGGAGTGCTGG + Intergenic
918657175 1:187042308-187042330 TCCATGGGAGGAGGAAATGCTGG + Intergenic
919038611 1:192350611-192350633 TCTCTGAGTGGAAAAAGTGCTGG + Intronic
919917792 1:202149720-202149742 TCACTGGGTGGAGGCAGAGCCGG - Intronic
920309713 1:205041907-205041929 TCCCTGAGTGGAGGAGGTCCTGG - Intergenic
922227137 1:223655310-223655332 TAGGTGAGTGGAGGAAGTGCAGG - Intronic
923664979 1:235991759-235991781 TCCCTGTGGGCAGGGAGTTCAGG - Intronic
1063962580 10:11319123-11319145 TGCCCGTGTGGAGGAAATTCTGG - Intronic
1065103112 10:22351424-22351446 ACCCTGTCTGCATGAAGTGCAGG + Intronic
1066356317 10:34687559-34687581 GCCCTTTGTGGAGGAAGTCTTGG - Intronic
1068840992 10:61613964-61613986 TGCCTGTGAGTAGGAGGTGCTGG + Intergenic
1069544415 10:69318569-69318591 TCCCTACGTGGGGGACGTGCAGG + Intronic
1070750086 10:78958899-78958921 TCTCTGTGTAGAGGCTGTGCTGG - Intergenic
1070799298 10:79235693-79235715 TCCCTGTGAGCAGGAGGTACCGG + Intronic
1073961005 10:108928299-108928321 ACCCTATGTGGAGCAACTGCAGG - Intergenic
1073970313 10:109040719-109040741 TCCCTGTGAGCAGAAAGAGCTGG - Intergenic
1076289412 10:129332902-129332924 TCCCTGTGTGATGGAAGTGTTGG - Intergenic
1076832384 10:133002447-133002469 TCCCTGTGGGGTAGAAGTCCCGG - Intergenic
1077001109 11:322757-322779 TCCCTGTGTTAAGGGAGTGCTGG + Intronic
1079101006 11:17542458-17542480 TCCCTGTGTGCAGGCAGGGCAGG - Intronic
1079816964 11:25073398-25073420 TCCCTGTGTGGAGGAAGTGCTGG + Intronic
1080451135 11:32379864-32379886 TCACTGTGGGGAGGTTGTGCAGG + Intergenic
1080964342 11:37196561-37196583 ACCCTTTGTGGAGGCAGTGAGGG - Intergenic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1081187442 11:40061738-40061760 TCCTGGTGTGTAGGAAGTGTTGG + Intergenic
1082960885 11:58917796-58917818 TCCCTTTGTGGAGGGAATGCTGG + Intronic
1083452150 11:62753364-62753386 TACCCCTGTGGAGGATGTGCTGG - Exonic
1084565895 11:69928597-69928619 TCCCTGTTGGGACGAAGGGCAGG - Intergenic
1084671536 11:70609457-70609479 TCCCTGTGTGGTGGAATTACTGG - Intronic
1086536007 11:87847613-87847635 TCCCTGTGTGGAGTGAGTAGGGG + Intergenic
1086964084 11:93009782-93009804 TCCAAGTGAGGAGGAAGTGTTGG - Intergenic
1087032212 11:93717008-93717030 TCCCTATGTTGAAGGAGTGCTGG + Intronic
1087871257 11:103295458-103295480 TCCCTAAGTTGAGGGAGTGCTGG - Intronic
1089561760 11:119346697-119346719 TCTCTGTGTGGGGGAAGGGATGG + Intergenic
1090875608 11:130786258-130786280 TCCATGTCTGGAAGAAGTCCTGG + Intergenic
1091191812 11:133701889-133701911 TTCCTGTGATGGGGAAGTGCTGG - Intergenic
1091458101 12:623204-623226 TCACTGTCAGGAGGGAGTGCTGG - Intronic
1091917073 12:4277314-4277336 ACCCTGTGAAGAGGAAGGGCTGG + Intronic
1092167693 12:6352977-6352999 GCCCTGGGAGGAGGAACTGCAGG + Intronic
1092436925 12:8456080-8456102 TCCCTGTGTTGAGAAGGTCCAGG - Exonic
1093815685 12:23543375-23543397 TTCCTGTTTTCAGGAAGTGCTGG - Exonic
1093888068 12:24486363-24486385 TGCCTGTGTGGAGTACGTCCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096567961 12:52496827-52496849 TCCCAGTGTGGAGGGAGGACAGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098405580 12:70122983-70123005 TCCCTCTGTGGATGGGGTGCTGG - Intergenic
1099285355 12:80708930-80708952 CCCCTGCGTGGAGGAAGTGGTGG + Exonic
1099780540 12:87189715-87189737 TACCTGTATGGAGAAAGTGGGGG + Intergenic
1102232037 12:111269431-111269453 TCCCAGTGTCCAGCAAGTGCCGG - Intronic
1102771800 12:115483831-115483853 TACTTGTGTAGAGGAAGTGTTGG - Intergenic
1103380153 12:120487940-120487962 TCCCTATGTTGAGGGAGTACTGG + Intronic
1103607523 12:122098255-122098277 TCTCTGTGGGGAAGAAGTGGGGG - Intronic
1104630546 12:130397758-130397780 TCTCTGTCTCGAGGGAGTGCGGG + Exonic
1107030926 13:35853078-35853100 TCCTTGAGTGAAGGAAGAGCTGG - Intronic
1107333237 13:39324516-39324538 GCCCTGTGTGGACGGAGTGAGGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108337790 13:49463826-49463848 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1112643832 13:101306864-101306886 TCTTTGTGTGGAGGAAGTTCAGG + Intronic
1113463471 13:110497553-110497575 GCCCTGAGTGGAGGTTGTGCTGG - Intronic
1113463479 13:110497596-110497618 GCCCTGAGTGGAGGTTGTGCTGG - Intronic
1113749202 13:112766776-112766798 TTCCTGTGAGGAGGATGTGGGGG + Intronic
1114060139 14:19010544-19010566 TCCTTGTGTGGCTGAGGTGCTGG - Intergenic
1114060434 14:19012315-19012337 TCCTTGTGTGGCTGAGGTGCTGG - Intergenic
1114101820 14:19387663-19387685 TCCTTGTGTGGCTGAGGTGCTGG + Intergenic
1114101919 14:19388291-19388313 TCCTTGTGTGGCTGAGGTGCTGG + Intergenic
1114102408 14:19391227-19391249 TCCTTGTGTGGCTGAGGTGCTGG + Intergenic
1114552811 14:23543633-23543655 GCCCTGTGTGAAGGAAGGGAAGG + Intronic
1116769068 14:49106318-49106340 TCCCTGCATGGAAAAAGTGCTGG - Intergenic
1117361676 14:54981298-54981320 TCCCTGTGTGGCTGAAATGATGG + Intronic
1119532468 14:75372534-75372556 TCCCTGTGTGGGGTAAGCGTAGG - Intergenic
1119827848 14:77672563-77672585 TCCTTGTGTGGAGGACTGGCTGG - Exonic
1120074012 14:80135227-80135249 TCCCTGGTTGGAGGAATTTCAGG + Intergenic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1121504931 14:94469727-94469749 GCTCTTTGTGGAGGAAGGGCGGG + Exonic
1121789626 14:96689427-96689449 TCCCTGGCTGGAGGAACTGATGG - Intergenic
1122400342 14:101463305-101463327 TCCCAGGGTGGAGGACGTGGAGG - Intergenic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1126602174 15:50439994-50440016 TCCCTGAGTCCAGGAAGTGGAGG + Intronic
1128512359 15:68321311-68321333 TGCCTGTGAGGAGGATGTCCAGG + Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129109519 15:73329434-73329456 TCCCAGTGTGAGGGAAGAGCAGG - Intronic
1129145281 15:73641488-73641510 TCCTTGTGTGGAGGGAGAACTGG - Intergenic
1129768219 15:78183617-78183639 TCACTGTGTATAGGAAGAGCGGG + Intronic
1129981769 15:79878709-79878731 TCCCTATGTGGAGGGAGTGGTGG + Intronic
1130399780 15:83539328-83539350 TCCCTGTATGGTGGAAGAGTGGG + Intronic
1132102862 15:99038690-99038712 TCCCAATGAGGAGAAAGTGCTGG + Intergenic
1132411264 15:101579777-101579799 CCCCTCTGTGGAGGAAGAACTGG + Intergenic
1132536548 16:484279-484301 TCCCTGTGTGGGGGAACTTAAGG - Intronic
1132668114 16:1091053-1091075 CCCCTGTGGGGAGGGAGTGGGGG + Intronic
1133015325 16:2937011-2937033 TCACTGTGAGGAGGAGGTGTGGG + Intronic
1134175803 16:12005249-12005271 TCCCTGTGTGGACCAAGGCCAGG - Intronic
1136690486 16:32024962-32024984 TCCCTTTGTGGGGGAGGTGAGGG - Intergenic
1136791071 16:32968522-32968544 TCCCTTTGTGGGGGAGGTGGGGG - Intergenic
1137526663 16:49242247-49242269 GCCCTGAGTTGGGGAAGTGCTGG - Intergenic
1137701553 16:50501497-50501519 GCCCTGTGTGCAGGCAGCGCTGG + Intergenic
1139827153 16:69766357-69766379 GTCCTGTGTGGAGAAAGTGAAGG - Intronic
1141562716 16:84880091-84880113 TCCCTGTGTGGAGGAGGAAAGGG - Intronic
1141680068 16:85538650-85538672 CCCCTGTGGGGAGGAAGTGGAGG + Intergenic
1141806608 16:86345886-86345908 TCCCCTTGTGGAGGAAAGGCTGG - Intergenic
1142010903 16:87713567-87713589 TGCCTGTGTGGAGCATGGGCGGG - Intronic
1203093281 16_KI270728v1_random:1229983-1230005 TCCCTTTGTGGGGGAGGTGTGGG - Intergenic
1142606015 17:1081414-1081436 TGCCTGGGAGGACGAAGTGCAGG - Intronic
1143615424 17:8046594-8046616 TGCCTGTGTGGGGGAAGGTCTGG + Intronic
1144312439 17:14025323-14025345 TATCTGTGTGCAGGAGGTGCCGG + Intergenic
1144332312 17:14236002-14236024 TATCTGTGTGCAGGAGGTGCCGG - Exonic
1144644880 17:16965622-16965644 TCCCTGGATGGAGGAGATGCAGG - Intronic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1145882846 17:28364682-28364704 TCCCTGGGTGGAGGGGATGCTGG - Intronic
1147000504 17:37359037-37359059 CCCCTGCGTGGAGGAACTGCTGG + Exonic
1147153343 17:38531098-38531120 TCCCTTTGTGGGGGAGGTGGGGG - Exonic
1147610909 17:41801369-41801391 TCCCGGTGTGCAGGGTGTGCAGG - Intergenic
1148344504 17:46894550-46894572 TCCCCATGGGGCGGAAGTGCCGG + Intergenic
1148864471 17:50621325-50621347 TCCCTGGGTGGTGGTAGTGTGGG + Intronic
1149908191 17:60546065-60546087 TCCATGAGTGGAGGTAGTGGTGG - Intergenic
1150265667 17:63831016-63831038 CCCCTGTGTGGAGGCCGAGCTGG - Exonic
1150305745 17:64083958-64083980 TCCCTGTGTGGAGGAGGGAGTGG - Intronic
1150980253 17:70133253-70133275 TTCATGTGTGGCGGAAGTGGTGG - Exonic
1151122381 17:71807629-71807651 TCTATGTGGGGAGGCAGTGCAGG + Intergenic
1151436147 17:74099120-74099142 GGCCTGTGTGGAGGCAGTGGGGG - Intergenic
1151805568 17:76402898-76402920 TCCCAGTGAGGAGGAAGTGGTGG + Intronic
1151923513 17:77175701-77175723 TCCCTGTGTTGAGGGAGTGCTGG + Intronic
1151927481 17:77209505-77209527 GCCCTCTGCGGAGGAAGGGCCGG - Intronic
1151977200 17:77489630-77489652 TCCCTGGGCGGAGGAAGCCCAGG + Intronic
1203165616 17_GL000205v2_random:90264-90286 TCCCTGTGTTGGGGGAGTGTTGG + Intergenic
1153198945 18:2630084-2630106 TCCTTGTGAGGATGAAGTGCTGG - Intergenic
1153962361 18:10150346-10150368 TGCCTGGGTGGAGGAGTTGCTGG - Intergenic
1155012452 18:21793316-21793338 TCACTTTGAGGAGAAAGTGCTGG + Intronic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1156762450 18:40609648-40609670 TACATGTGTGGTGGGAGTGCTGG - Intergenic
1156849087 18:41704886-41704908 TGCCTGTGTGGGGTAAGTGAGGG + Intergenic
1159054777 18:63452762-63452784 TCCCTATGTTGAAGGAGTGCTGG - Intergenic
1159523789 18:69561683-69561705 TTCATGTGTGTAGGAAGTTCAGG + Intronic
1159728113 18:71989176-71989198 TCCCTGAGTGCAGAAACTGCTGG + Intergenic
1159899036 18:74025114-74025136 TCCCTGTGAGGAGGGAGGGGAGG - Intergenic
1160786263 19:901384-901406 TCCCCGTGTGGAGGGAGTGAGGG + Intronic
1160967450 19:1752971-1752993 CCTCTTTGTGGAGGAAGTGGGGG - Exonic
1161648003 19:5466237-5466259 TCCCTGTTTCCTGGAAGTGCAGG - Intergenic
1161893826 19:7064833-7064855 TCACTGTCTTGAGGAAGTGTTGG - Intergenic
1163045635 19:14639672-14639694 TCCCAGTGTGCAGGGATTGCAGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163790229 19:19302098-19302120 TGCCTGTGGGGAGGCAGAGCTGG + Intronic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164789295 19:30962235-30962257 TCCCTGTGTGGAGGAGGGGTGGG - Intergenic
1165153579 19:33774526-33774548 TCCCCAGGTGGAGGAACTGCTGG + Intergenic
1165429563 19:35764847-35764869 TCCATGTGTGGAGGTTCTGCAGG - Exonic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1165944896 19:39436104-39436126 GCCCTGTGAGGCGGAAGTGGCGG + Intergenic
1167496281 19:49820597-49820619 TCTCTATGTTGAGGGAGTGCTGG + Intronic
1167588009 19:50385842-50385864 GACCTGTGGGGGGGAAGTGCAGG - Intronic
1167767281 19:51491827-51491849 TCCCTGAATGGAGGAAGAGAAGG + Exonic
1168705799 19:58469708-58469730 GTCCTGTGAGGAGGAGGTGCAGG - Exonic
924998785 2:387071-387093 TCACTGTTTGGAGAAAGTGAAGG - Intergenic
925282263 2:2692906-2692928 TCCTTCTGGGGAGGAAGTGTGGG - Intergenic
925353828 2:3223288-3223310 TGCATGTGTGGGGGGAGTGCAGG - Intronic
925751701 2:7095434-7095456 ACCCTGTGAGGAGGGAGGGCAGG + Intergenic
927132717 2:20073982-20074004 TCCCTATGTTGAGGGAGGGCTGG - Intergenic
927240510 2:20916323-20916345 GGCCTGGGTGGAGGCAGTGCAGG - Intergenic
927848478 2:26484416-26484438 TCCCTGGGGGAAGGAAGGGCTGG + Intronic
929073870 2:38061218-38061240 TCCCCATGTGAAGGAAATGCAGG + Intronic
929453921 2:42053442-42053464 TCCCTGGGTGGAGGAGGAGTGGG - Intronic
929893624 2:45939058-45939080 TGCCAGGGTGGAGGAGGTGCCGG + Intronic
930036709 2:47090179-47090201 TCTATGTGTGTAGGAGGTGCGGG - Intronic
932651349 2:73561334-73561356 TCCCTGTGTTGAAGGAGTGCTGG + Intronic
933532744 2:83531092-83531114 TCCCTCTGTAGAGGGAGTGCTGG - Intergenic
933592461 2:84247917-84247939 TCCCTGTGTTGGAGAAGGGCTGG - Intergenic
933839488 2:86275100-86275122 TCCCTGTGAGGCTGAAGCGCAGG - Intronic
934766778 2:96884229-96884251 ACCCTGTGTCCAGGAAGGGCAGG + Intronic
937303055 2:120854989-120855011 GCTCTGTGTGGAGGGTGTGCAGG - Intronic
937771213 2:125722488-125722510 TCCTTATGGGGAAGAAGTGCAGG + Intergenic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938577209 2:132615853-132615875 TCCCTGTGTCAGGCAAGTGCAGG - Intronic
942795623 2:179815269-179815291 TACCTGTGAGGAGGAAGTACTGG + Intronic
943117468 2:183691515-183691537 TCCCTGTGTGCTGGCAGTGGTGG - Intergenic
943367216 2:186977703-186977725 TCCCTGTGGGGAAGAAATGTGGG - Intergenic
944968840 2:204967949-204967971 ACCCTGTTAGGAGGAACTGCTGG - Intronic
945977983 2:216285432-216285454 TCCCTGTGAGGAGCAAATGGGGG - Intronic
946650585 2:221889238-221889260 TCTTTGAGAGGAGGAAGTGCAGG + Intergenic
946686413 2:222276281-222276303 TCCCTGCGTGGAAGAAGAGCCGG + Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948805129 2:240450657-240450679 TTCCTCTGGGGAGGAGGTGCTGG + Exonic
949052890 2:241906714-241906736 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1169350795 20:4866553-4866575 TCCCTGTATGGGGGATGTGAGGG - Intronic
1169488548 20:6053024-6053046 TCCTTGAGGGGAGGAAGAGCAGG - Intronic
1169950498 20:11038093-11038115 TCCCTGTGTGGAGGAACAGATGG - Intergenic
1171972324 20:31572199-31572221 TCTCTGTGTTGAGGAAGAGGAGG + Intronic
1172096779 20:32464288-32464310 TGCCTTTCTGGAGGAAGAGCTGG - Intronic
1172872647 20:38145206-38145228 TGCTGGTGTGGAGGATGTGCTGG + Intronic
1173246293 20:41340110-41340132 TCCCTGTCTGCAGGCACTGCGGG - Intergenic
1173679081 20:44863619-44863641 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
1173987655 20:47274971-47274993 TTCCTGTGTGAAGGGAGTGAGGG + Intronic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1176406138 21:6368815-6368837 TCCCTGTGTTGGGGGAGTGTTGG - Intergenic
1178256040 21:31053414-31053436 TCCCTGTGTGGAAGACTTGTAGG + Intergenic
1178702279 21:34843948-34843970 GCCCTCTGTGGGGGAAGTGGAGG + Intronic
1178834843 21:36088095-36088117 GCCCTGTGTGGGGGAAGGCCAGG - Intergenic
1179167546 21:38946658-38946680 TCTCTGTGGGGAGGATGTGCTGG + Intergenic
1179981050 21:44896219-44896241 TACCTGTGTGGTGGAAATTCTGG - Intronic
1180072264 21:45442481-45442503 TCCAGGAGTGGAGGAAGTGGAGG - Intronic
1180478915 22:15734927-15734949 TCCTTGTGTGGCTGAGGTGCTGG - Intergenic
1180894164 22:19316210-19316232 TCCTTATGTGGAGGGAGTGCTGG - Intergenic
1182394929 22:30028386-30028408 TCTCTGTGTGGAGAGAGGGCGGG - Intronic
1183164702 22:36139047-36139069 GCCCAGTGTGGAGGATGGGCAGG + Intergenic
1183171001 22:36188197-36188219 GCCCAATGTGGAGGAAGAGCTGG + Intergenic
1183211130 22:36452062-36452084 TCCTTGGGTGAAGGAAGTGTTGG - Intergenic
1183506335 22:38211133-38211155 ATCCTGTGTTGAGGAAGGGCGGG + Intronic
1184467213 22:44675941-44675963 TCTCTGTGTGGGCGAGGTGCTGG + Intronic
1185137918 22:49083823-49083845 TCCCTGGATGCAGGAGGTGCTGG + Intergenic
1185383643 22:50521760-50521782 CCCCTGTGTGGAGGAGGCTCTGG + Exonic
949595907 3:5547313-5547335 TCTCTGTTGGGGGGAAGTGCTGG + Intergenic
950622144 3:14214555-14214577 TTCCTGTGTTGCGGAAGTGTGGG + Intergenic
951171225 3:19543987-19544009 TCCCAGTGTGGAGGCATTGGAGG - Intergenic
951538959 3:23764528-23764550 TGGATGTGTGGAGTAAGTGCTGG - Intergenic
952853090 3:37744929-37744951 ACCCTGTGTGGATGAAGTGAAGG + Intronic
953055319 3:39383379-39383401 TCCCGGGGTGGAGGAAGCGCCGG - Exonic
953980353 3:47410336-47410358 TCCCTATGTGGGGGTAGGGCCGG + Exonic
954716110 3:52527716-52527738 TCTCTGTGTGGAGGAGTTTCAGG + Exonic
955133824 3:56196277-56196299 TCTCTGTGAGGAGGGAGTGTGGG - Intronic
955726622 3:61940197-61940219 TCGCTGGGTGGATGAAGTGCTGG + Intronic
956049233 3:65229790-65229812 TTCCTTTGTGGAGGAACTGAAGG - Intergenic
956896327 3:73664336-73664358 TTCCTTTGAGGAGCAAGTGCTGG - Intergenic
958709604 3:97701301-97701323 TCCCTGTGTGGAGATAGTAGGGG + Intronic
959843699 3:111008523-111008545 TCCCTCAGTGGAGCAAGGGCTGG - Intergenic
959961255 3:112302004-112302026 TCCCTGTGTTGAGGGGGTGCTGG - Intergenic
959962002 3:112308059-112308081 TCCCTGTGTTGAGGGAGTGCTGG - Intergenic
960738789 3:120810073-120810095 TCCCTGTATGGTGGATGTGATGG - Intergenic
961047565 3:123720095-123720117 TCCCAGTGTGGGGGATGTACTGG - Intronic
961270395 3:125683536-125683558 TCCCAGTGTGGGGGATGTACTGG + Intergenic
961317765 3:126052264-126052286 ACCCTATGTGGAGGGTGTGCAGG - Intronic
962238598 3:133730833-133730855 TCCCTGAGTGGTAGAAGTGTAGG + Intergenic
962406349 3:135103825-135103847 TCCATGAGAGGAGGAAGTGGAGG - Intronic
963237511 3:142970335-142970357 TCCCTGTCTGGAGACAGTACTGG + Intronic
964559137 3:157974174-157974196 TCACTCTGTGGAGGATGTGAAGG + Intergenic
964753560 3:160074620-160074642 TCCCTGTGTGGAAGGAATGTGGG - Intergenic
965390362 3:168096000-168096022 TCCCTTCGGGGAGGCAGTGCCGG + Intergenic
965850194 3:173013860-173013882 TCCCTAGGTTGAGGGAGTGCTGG + Intronic
966559002 3:181297858-181297880 TGCCTGTGTGGAGGGAGGGCAGG - Intergenic
969723973 4:8908331-8908353 TCCCTGGGTGGAGGGACTGGCGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
971418114 4:26452202-26452224 TCCCTTGGTGGAGGAGGTGAGGG + Intergenic
973966264 4:56165080-56165102 TCACTGTGTTAAGGAAGTTCAGG + Intergenic
978165459 4:105601681-105601703 TGCCTGTGTGTAGGCAGAGCAGG + Intronic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983593645 4:169441810-169441832 CCCCTGTGTGGTGCATGTGCAGG - Intronic
984821355 4:183885516-183885538 TCCATCTGTGGAGGCTGTGCAGG + Intronic
985475049 5:74144-74166 TCCGTGTGTGGAGGGAGCCCCGG - Intergenic
985641129 5:1063958-1063980 TGCAGGTGTGGAGGAAGTGCCGG - Exonic
985702989 5:1384746-1384768 ACCCTGGGTGGAGAAAGTACAGG + Intergenic
987714867 5:21554904-21554926 TCCATGTGTTGAAGGAGTGCTGG + Intergenic
990185682 5:53206714-53206736 TCCCTTTGAGGAGGAAGGCCAGG - Intergenic
990525073 5:56617503-56617525 CCCATGTGTCTAGGAAGTGCAGG - Intergenic
992348241 5:75902338-75902360 TCCCTGTGTGCAAGAAATTCAGG + Intergenic
992807328 5:80350735-80350757 TCCGTGTGTGTCGGCAGTGCTGG - Intergenic
993635386 5:90336700-90336722 ACCCTGTGATGAGGAAGGGCTGG - Intergenic
997364704 5:133318549-133318571 TGCCTGTGTGGAGGGTCTGCAGG + Intronic
997640349 5:135444918-135444940 TTCCTGTGTGGATGGAGTGTTGG + Exonic
997657517 5:135566537-135566559 TCCTTGTGTGGAGGTTGAGCAGG + Intergenic
997800962 5:136861635-136861657 TCCCTGGGTGGTGGGAGTGAGGG + Intergenic
999323915 5:150631442-150631464 GCCCTGAGGGGAGAAAGTGCTGG + Intronic
1000914654 5:167066053-167066075 TCCCTGGGTGGTGTGAGTGCTGG + Intergenic
1003213976 6:4091954-4091976 TCGCTATGTTGAGGGAGTGCTGG - Intronic
1003218504 6:4135988-4136010 CCCGGGAGTGGAGGAAGTGCGGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003255422 6:4470955-4470977 TCCCTGTGTGTAGAACGTCCTGG - Intergenic
1003341334 6:5224070-5224092 TCCATGTGTGGAGAAATAGCAGG - Intronic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1005423301 6:25675158-25675180 TCCCTTTGTTGAGGGAGTGCTGG - Intronic
1005447742 6:25942016-25942038 TCCCTTTATGGAGTAATTGCAGG - Intergenic
1005922515 6:30415111-30415133 TCCCTGTGTGGGCTGAGTGCCGG - Intergenic
1006059681 6:31410944-31410966 TCCCTGTGTGGGCTGAGTGCCGG - Intronic
1006182482 6:32162709-32162731 ACCCTGTGGGGAGGAGGTCCAGG + Intronic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007790995 6:44308204-44308226 TTGCTGTGTGGAGGATGAGCTGG - Intronic
1010518686 6:76806251-76806273 CCCCTGTTTGCAGTAAGTGCTGG + Intergenic
1013282769 6:108654193-108654215 TCTCTGTGTGCCGGAAGTGCAGG + Intronic
1014024755 6:116632330-116632352 TCCTAGTGTGGAGGAGGAGCAGG + Exonic
1015660878 6:135572082-135572104 TCCCAGAGTGGACGAACTGCTGG - Intergenic
1018098988 6:160419643-160419665 GCCCTGTCAGGAGAAAGTGCTGG - Intronic
1018123825 6:160662645-160662667 TCTGTGTGTGTAGGGAGTGCAGG - Intronic
1018239946 6:161763851-161763873 GCCTCGTGTGGAGGAAGGGCAGG - Intronic
1018782192 6:167078292-167078314 TCCCTGTGAGGATGCAGTGAAGG - Intergenic
1019615866 7:1961098-1961120 TCCCTGTGTGGAGGTTGCCCTGG - Intronic
1020065190 7:5183006-5183028 TACATGAGTGGAGGAAGGGCTGG - Intergenic
1020088155 7:5322729-5322751 TCCCACTGAGGAGGAAGGGCAGG - Intronic
1020962406 7:14821774-14821796 TCTCTGTGTGGAGGACATGTTGG + Intronic
1021818938 7:24477693-24477715 TCCCTGTGTGGAATTAGTTCAGG - Intergenic
1022517982 7:30987842-30987864 TCCCTGAGAGAAGGAAGGGCAGG + Intronic
1025142694 7:56479047-56479069 TCCCTGAGTGGAGGAAGAGAGGG + Intergenic
1025610717 7:63073537-63073559 TCCCTGAGTGGAGGAAGAGAGGG - Intergenic
1026038134 7:66844554-66844576 TCCCTGGCTGGAGGAGGTGTTGG + Intergenic
1026895357 7:74007149-74007171 GCCCAGTGTGGAGGAAAGGCTGG - Intergenic
1031790689 7:126099387-126099409 TCCATCTCTGAAGGAAGTGCAGG - Intergenic
1031970472 7:128061431-128061453 TCCCTGTGTGGAGAAGCTGTGGG + Intronic
1032162408 7:129520915-129520937 TCCCTGTGAAGAGGAAGAGGAGG - Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1033033828 7:137852021-137852043 GTCCTGTCTGGAAGAAGTGCTGG - Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1034398847 7:150848184-150848206 TCGCTGTGCTGAGGAAGGGCAGG - Intronic
1037814868 8:22106834-22106856 TCTCTGTGGGGAGAAAGTGATGG - Intergenic
1037881651 8:22576387-22576409 TCCCTGTGGGGTGGCAGTGGTGG + Intergenic
1039133365 8:34292932-34292954 TCCCTGTACTGAGGAAGTTCTGG - Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1041981486 8:63866373-63866395 TGCCTGTGTGCAGGAAGAGTTGG - Intergenic
1042221959 8:66483123-66483145 TCGCTGAGTGGAGGCAGTTCTGG - Intronic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044671364 8:94684287-94684309 TCTCTGAGTGGTAGAAGTGCAGG + Intronic
1046658656 8:116924768-116924790 TCCCTGTGTTGAGGGAGTGCTGG + Intergenic
1047188343 8:122655776-122655798 CCACTGTCTGGAGGAAGTCCTGG - Intergenic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1047958706 8:129995243-129995265 TCCCAGGGTGGCGGAAGTGAGGG + Intronic
1048566123 8:135599829-135599851 AGCCTGTGCGGAGGAATTGCGGG + Intronic
1048974164 8:139661916-139661938 TTCCTGTGGGGAGGGACTGCTGG + Intronic
1049457777 8:142702480-142702502 TCCCTGTGGGCAGAATGTGCTGG - Intronic
1051860107 9:21615131-21615153 TCCCTGTATAGAGGAAGAGGAGG + Intergenic
1052379585 9:27755644-27755666 TACATGTGTGCAGGACGTGCAGG - Intergenic
1053290983 9:36879547-36879569 TCCCTGGGTGTGGGGAGTGCTGG + Intronic
1053401742 9:37830524-37830546 TCCCTCTGGGGAGGAAGAGAAGG + Intronic
1053781720 9:41616612-41616634 TCCCTATGTTGAGGGAGCGCTGG + Intergenic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1057160306 9:92884315-92884337 GCCCTGTGTGGAGAAAGGACTGG - Intergenic
1057216362 9:93230957-93230979 TCCTTGTGTGCAGGAACAGCAGG - Exonic
1057822440 9:98342815-98342837 GGCCTGGGTGGGGGAAGTGCTGG - Intronic
1061629074 9:131860246-131860268 TCCATGTGTGTCGGCAGTGCTGG - Exonic
1062138744 9:134943981-134944003 TCCCTGTGTGTGGGCAGGGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188481657 X:30642294-30642316 TACATGTGTGCAGGATGTGCAGG - Intergenic
1188676478 X:32947128-32947150 TCCCTGCATGGAGGATATGCTGG - Intronic
1189125054 X:38437162-38437184 TCCCTGTGAGGACAAACTGCTGG - Intronic
1189198104 X:39168453-39168475 CCCCTGTGTGGGGGATGTGGGGG + Intergenic
1189226348 X:39416480-39416502 TGCCTGTGTGGAGGGATTTCAGG - Intergenic
1190408526 X:50111643-50111665 TCTCTGAGTGAAGGAACTGCAGG - Intergenic
1190508754 X:51155978-51156000 TTCCTGTGTGGATGAAGAACAGG - Intergenic
1190777337 X:53563527-53563549 TGCCTGTGTGGGGGAGGTGGTGG - Intronic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1193521238 X:82531468-82531490 TGCTGGTGTGGAGGAAGTTCAGG - Intergenic
1197178718 X:123511601-123511623 GCCCTGTGAGGATGAACTGCTGG - Intergenic
1197209507 X:123817286-123817308 TCCCTGTACGGAGAAAGAGCTGG + Intergenic
1199396876 X:147348280-147348302 TGTCTGTGTGGAGGAAGAGGGGG + Intergenic
1199678055 X:150204702-150204724 AATCTGTGAGGAGGAAGTGCTGG - Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201428291 Y:13878603-13878625 TCCCTATATTGAGGGAGTGCTGG + Intergenic
1202237472 Y:22728550-22728572 TCCCTGCGTTGAGGGTGTGCTGG - Intergenic