ID: 1079818620

View in Genome Browser
Species Human (GRCh38)
Location 11:25094929-25094951
Sequence CATGATTTCTGTTAAGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079818620_1079818623 -6 Left 1079818620 11:25094929-25094951 CCACTGGCTTAACAGAAATCATG No data
Right 1079818623 11:25094946-25094968 ATCATGACTGGAAGGCCTACAGG No data
1079818620_1079818626 23 Left 1079818620 11:25094929-25094951 CCACTGGCTTAACAGAAATCATG No data
Right 1079818626 11:25094975-25094997 ACAATCATGATGGAATGTGAAGG No data
1079818620_1079818628 25 Left 1079818620 11:25094929-25094951 CCACTGGCTTAACAGAAATCATG No data
Right 1079818628 11:25094977-25094999 AATCATGATGGAATGTGAAGGGG No data
1079818620_1079818625 13 Left 1079818620 11:25094929-25094951 CCACTGGCTTAACAGAAATCATG No data
Right 1079818625 11:25094965-25094987 CAGGAAACTTACAATCATGATGG 0: 235
1: 3062
2: 4065
3: 3194
4: 2178
1079818620_1079818627 24 Left 1079818620 11:25094929-25094951 CCACTGGCTTAACAGAAATCATG No data
Right 1079818627 11:25094976-25094998 CAATCATGATGGAATGTGAAGGG 0: 3
1: 107
2: 1249
3: 2392
4: 4938

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079818620 Original CRISPR CATGATTTCTGTTAAGCCAG TGG (reversed) Intergenic
No off target data available for this crispr