ID: 1079819149

View in Genome Browser
Species Human (GRCh38)
Location 11:25103470-25103492
Sequence CTGTTTCCTCACATTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079819149_1079819150 -5 Left 1079819149 11:25103470-25103492 CCTTCTTCAATGTGAGGAAACAG No data
Right 1079819150 11:25103488-25103510 AACAGTGCTCCTCCTCTCAGAGG No data
1079819149_1079819154 20 Left 1079819149 11:25103470-25103492 CCTTCTTCAATGTGAGGAAACAG No data
Right 1079819154 11:25103513-25103535 GCAACATCAAGGCACCATGTAGG No data
1079819149_1079819153 9 Left 1079819149 11:25103470-25103492 CCTTCTTCAATGTGAGGAAACAG No data
Right 1079819153 11:25103502-25103524 TCTCAGAGGATGCAACATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079819149 Original CRISPR CTGTTTCCTCACATTGAAGA AGG (reversed) Intergenic
No off target data available for this crispr