ID: 1079820906

View in Genome Browser
Species Human (GRCh38)
Location 11:25126997-25127019
Sequence CACAATTAGAACTAAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079820905_1079820906 29 Left 1079820905 11:25126945-25126967 CCGTTGTTAAAGTATAAACAAAA No data
Right 1079820906 11:25126997-25127019 CACAATTAGAACTAAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079820906 Original CRISPR CACAATTAGAACTAAGAGCA TGG Intergenic
No off target data available for this crispr