ID: 1079821518

View in Genome Browser
Species Human (GRCh38)
Location 11:25136658-25136680
Sequence CAGTGTCACCAATTTAACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079821516_1079821518 -9 Left 1079821516 11:25136644-25136666 CCATTCTGCCTTCTCAGTGTCAC No data
Right 1079821518 11:25136658-25136680 CAGTGTCACCAATTTAACAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079821518 Original CRISPR CAGTGTCACCAATTTAACAG CGG Intergenic
No off target data available for this crispr