ID: 1079827377

View in Genome Browser
Species Human (GRCh38)
Location 11:25214084-25214106
Sequence ATTTCTTCGTAGCAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079827372_1079827377 10 Left 1079827372 11:25214051-25214073 CCTATTTTCTTCACAAATTACCC No data
Right 1079827377 11:25214084-25214106 ATTTCTTCGTAGCAGTATGAGGG No data
1079827374_1079827377 -10 Left 1079827374 11:25214071-25214093 CCCAGTCTTAGGTATTTCTTCGT No data
Right 1079827377 11:25214084-25214106 ATTTCTTCGTAGCAGTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079827377 Original CRISPR ATTTCTTCGTAGCAGTATGA GGG Intergenic
No off target data available for this crispr