ID: 1079838742

View in Genome Browser
Species Human (GRCh38)
Location 11:25367547-25367569
Sequence CAAAATGGTGATAATTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079838742_1079838747 4 Left 1079838742 11:25367547-25367569 CCCATATAATTATCACCATTTTG No data
Right 1079838747 11:25367574-25367596 AAGCCATTCAACAGGTCTCTAGG No data
1079838742_1079838746 -4 Left 1079838742 11:25367547-25367569 CCCATATAATTATCACCATTTTG No data
Right 1079838746 11:25367566-25367588 TTTGGTTAAAGCCATTCAACAGG No data
1079838742_1079838748 5 Left 1079838742 11:25367547-25367569 CCCATATAATTATCACCATTTTG No data
Right 1079838748 11:25367575-25367597 AGCCATTCAACAGGTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079838742 Original CRISPR CAAAATGGTGATAATTATAT GGG (reversed) Intergenic
No off target data available for this crispr