ID: 1079839524

View in Genome Browser
Species Human (GRCh38)
Location 11:25378851-25378873
Sequence GTTCAAAGCCACAGTTAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079839524_1079839527 23 Left 1079839524 11:25378851-25378873 CCTATTTAACTGTGGCTTTGAAC No data
Right 1079839527 11:25378897-25378919 CTTCCTCCTACCTATGCTTCCGG No data
1079839524_1079839528 24 Left 1079839524 11:25378851-25378873 CCTATTTAACTGTGGCTTTGAAC No data
Right 1079839528 11:25378898-25378920 TTCCTCCTACCTATGCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079839524 Original CRISPR GTTCAAAGCCACAGTTAAAT AGG (reversed) Intergenic
No off target data available for this crispr