ID: 1079844304

View in Genome Browser
Species Human (GRCh38)
Location 11:25445626-25445648
Sequence CTGAAGCCTGAGAAGGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079844301_1079844304 7 Left 1079844301 11:25445596-25445618 CCACTGAGGAGGTAACAACTGAG No data
Right 1079844304 11:25445626-25445648 CTGAAGCCTGAGAAGGAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079844304 Original CRISPR CTGAAGCCTGAGAAGGAGCT CGG Intergenic
No off target data available for this crispr