ID: 1079849994

View in Genome Browser
Species Human (GRCh38)
Location 11:25520556-25520578
Sequence TGTTAGCTGAAACTTTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079849993_1079849994 -7 Left 1079849993 11:25520540-25520562 CCAGCACTACAAAAGATGTTAGC No data
Right 1079849994 11:25520556-25520578 TGTTAGCTGAAACTTTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079849994 Original CRISPR TGTTAGCTGAAACTTTGTGC TGG Intergenic
No off target data available for this crispr