ID: 1079852178

View in Genome Browser
Species Human (GRCh38)
Location 11:25548668-25548690
Sequence TAGCTGTTCTACAGGGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079852171_1079852178 15 Left 1079852171 11:25548630-25548652 CCAAAAGTCATGCTGTGACATTA No data
Right 1079852178 11:25548668-25548690 TAGCTGTTCTACAGGGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079852178 Original CRISPR TAGCTGTTCTACAGGGGAAA AGG Intergenic
No off target data available for this crispr