ID: 1079854576

View in Genome Browser
Species Human (GRCh38)
Location 11:25586096-25586118
Sequence TTGGAGAAGTGGTAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079854570_1079854576 1 Left 1079854570 11:25586072-25586094 CCCTATAAAAAGTTGTTGAGAGG No data
Right 1079854576 11:25586096-25586118 TTGGAGAAGTGGTAGTTGGTTGG No data
1079854569_1079854576 24 Left 1079854569 11:25586049-25586071 CCTGCTGGTTGTGGAAGTATTTT No data
Right 1079854576 11:25586096-25586118 TTGGAGAAGTGGTAGTTGGTTGG No data
1079854572_1079854576 0 Left 1079854572 11:25586073-25586095 CCTATAAAAAGTTGTTGAGAGGC No data
Right 1079854576 11:25586096-25586118 TTGGAGAAGTGGTAGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079854576 Original CRISPR TTGGAGAAGTGGTAGTTGGT TGG Intergenic
No off target data available for this crispr