ID: 1079854760

View in Genome Browser
Species Human (GRCh38)
Location 11:25588656-25588678
Sequence CGCTATGATCAGAAGCAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 4, 2: 2, 3: 9, 4: 125}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079854760_1079854762 -9 Left 1079854760 11:25588656-25588678 CCACTCTGCTTCTGATCATAGCG 0: 1
1: 4
2: 2
3: 9
4: 125
Right 1079854762 11:25588670-25588692 ATCATAGCGCCTCTTTCCCTGGG No data
1079854760_1079854764 0 Left 1079854760 11:25588656-25588678 CCACTCTGCTTCTGATCATAGCG 0: 1
1: 4
2: 2
3: 9
4: 125
Right 1079854764 11:25588679-25588701 CCTCTTTCCCTGGGCATACAAGG No data
1079854760_1079854761 -10 Left 1079854760 11:25588656-25588678 CCACTCTGCTTCTGATCATAGCG 0: 1
1: 4
2: 2
3: 9
4: 125
Right 1079854761 11:25588669-25588691 GATCATAGCGCCTCTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079854760 Original CRISPR CGCTATGATCAGAAGCAGAG TGG (reversed) Intergenic
907534101 1:55133375-55133397 CGCAATGATCAGATTCAAAGAGG + Intronic
909710030 1:78638586-78638608 AGCTATGCTCAAAAGCAGAATGG - Intronic
911003338 1:93190921-93190943 CGATATGACAGGAAGCAGAGTGG - Intronic
914442452 1:147719321-147719343 AGCTATGTCCAGAAGCTGAGCGG - Intergenic
915719675 1:157975585-157975607 TGCTCTGTTCAGAAGGAGAGAGG + Intergenic
921783115 1:219192461-219192483 CGTAATGATGAGAAACAGAGTGG - Intronic
922456235 1:225775817-225775839 AGCAATGAGCAGAGGCAGAGAGG - Intergenic
922615422 1:226958437-226958459 CGCCAGGATCGGAGGCAGAGTGG - Intronic
1064185641 10:13159650-13159672 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1077290967 11:1792670-1792692 CGTTATGACAGGAAGCAGAGTGG + Intergenic
1079029395 11:16974874-16974896 CGTTATGACAGGAAGCAGAGTGG - Intronic
1079136572 11:17779003-17779025 GGCTCTGGTCAGCAGCAGAGGGG + Intronic
1079854760 11:25588656-25588678 CGCTATGATCAGAAGCAGAGTGG - Intergenic
1082802673 11:57426167-57426189 CGCCATGAGCAGAAGTGGAGTGG + Exonic
1088547954 11:110980675-110980697 TGCTATTACCAGAAGGAGAGGGG + Intergenic
1088866932 11:113856991-113857013 AGCTATCATCAGAAGTAGAGAGG + Intronic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090924028 11:131234062-131234084 AGCTGTGGTCAGAAGCAGAATGG - Intergenic
1094370187 12:29729355-29729377 CCTTCTGATGAGAAGCAGAGTGG - Intronic
1095765978 12:45896292-45896314 TGCTATGATTGGAAGCAGAGTGG + Intronic
1097796865 12:63871920-63871942 TGCTATGATCAGAAGCAGAGTGG - Intronic
1098338846 12:69431153-69431175 GGCTCTGATAAGAAGAAGAGAGG + Intergenic
1107062057 13:36170220-36170242 AGCTCTGAGTAGAAGCAGAGGGG + Intronic
1114739872 14:25084706-25084728 CGCTATGACCAGAGGAAAAGGGG + Intergenic
1115303467 14:31910935-31910957 GGCCATGATAGGAAGCAGAGTGG - Intergenic
1115490952 14:33957607-33957629 ATATATGAACAGAAGCAGAGAGG - Intronic
1116820015 14:49618965-49618987 CGCTATGATCGGAAGCAGAGTGG - Exonic
1118387555 14:65268943-65268965 CGCTGTGATCAGAAGCAGAGTGG + Intergenic
1119641226 14:76316401-76316423 TGCTAGGAGCAGGAGCAGAGGGG - Intronic
1125016574 15:34943197-34943219 CGTTATGACAGGAAGCAGAGTGG + Intronic
1127267151 15:57371662-57371684 GGCTCTGAGCAGGAGCAGAGGGG - Intergenic
1130688056 15:86056534-86056556 GGCCAGGAGCAGAAGCAGAGAGG + Intergenic
1135642292 16:24131254-24131276 ATCTAAAATCAGAAGCAGAGAGG + Intronic
1138209656 16:55152792-55152814 CACCATGATCAGAAGTAGATTGG + Intergenic
1138254292 16:55540150-55540172 CTCTATGTTGGGAAGCAGAGAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1143445146 17:7004755-7004777 AGCTTTGATCATAAGCAGAGAGG + Intronic
1146612136 17:34316166-34316188 CTCTCTGATCAAAATCAGAGAGG + Intergenic
1149928653 17:60727346-60727368 CGCTATGATCGGAAGCAGAGTGG - Intronic
1151225012 17:72641276-72641298 CGGTATGATGAGAAGTAGAGAGG - Intergenic
1151634806 17:75338944-75338966 CGTTATGACAGGAAGCAGAGTGG + Intronic
1154497949 18:14975988-14976010 AGCCAAGATCAGATGCAGAGAGG - Intergenic
1156612218 18:38738328-38738350 CGCTAACATGAGAAGCACAGTGG - Intergenic
1158348057 18:56535727-56535749 CTCTCTAATCAGAGGCAGAGTGG - Intergenic
1158769502 18:60498021-60498043 TGCTATGATCAGCAACAGAATGG - Intergenic
1159869842 18:73748017-73748039 TGCTCTGATCAGAAGGAGGGAGG - Intergenic
1162265126 19:9566748-9566770 CTCTATGAACAGAAGCAATGTGG - Exonic
929676801 2:43942019-43942041 GGATATAATCAGAAGCACAGAGG + Intronic
932175240 2:69594922-69594944 CGTTATGACAGGAAGCAGAGTGG - Intronic
932432654 2:71685174-71685196 CGCTGTGGGCAGAAGCAGAGTGG + Intronic
934945610 2:98539097-98539119 CACAATGATAAGCAGCAGAGAGG - Intronic
935428271 2:102944400-102944422 CACTTTGATCACAAGCAGTGTGG - Intergenic
938082184 2:128376192-128376214 TGCTTTCCTCAGAAGCAGAGAGG + Intergenic
938552301 2:132393523-132393545 GGATGTGATCAGGAGCAGAGGGG - Intergenic
940396247 2:153195931-153195953 TGGGATGATCAGATGCAGAGAGG - Intergenic
944371789 2:198993027-198993049 AGCTATTATCAGCAGAAGAGTGG + Intergenic
1169308474 20:4515368-4515390 CACTATTAACAGAAGCAGACAGG - Intergenic
1170346353 20:15391110-15391132 CGCTATGATAACAAGTAGAAAGG + Intronic
1173007994 20:39155908-39155930 AGCCATGATGAGAAGAAGAGAGG + Intergenic
1174102080 20:48135360-48135382 GGTTATGAACAGAAGCAGAATGG + Intergenic
1174311825 20:49662087-49662109 TGTTAGAATCAGAAGCAGAGAGG - Intronic
1176343550 21:5720248-5720270 CGTTCTGATCAGAAGCTGACAGG - Intergenic
1176501277 21:7604208-7604230 CGTTCTGATCAGAAGCTGACAGG + Intergenic
1176537871 21:8118317-8118339 CGTTCTGATCAGAAGCTGACAGG - Intergenic
1177334875 21:19710398-19710420 TGCCAGGATTAGAAGCAGAGAGG - Intergenic
1181345143 22:22214627-22214649 CTCAAAGATCTGAAGCAGAGAGG - Intergenic
1185309694 22:50147244-50147266 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309701 22:50147292-50147314 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309708 22:50147340-50147362 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309715 22:50147388-50147410 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309722 22:50147436-50147458 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309729 22:50147484-50147506 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309736 22:50147532-50147554 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1185309743 22:50147580-50147602 CGCTCTGTGCAGAAGCAGGGAGG + Intronic
1203242818 22_KI270733v1_random:34672-34694 CGTTCTGATCAGAAGCTGACAGG - Intergenic
949884566 3:8683020-8683042 CGCAATGATTAGAAGCAGAGTGG + Intronic
957593047 3:82225295-82225317 CGCTGTGGGCAGTAGCAGAGAGG + Intergenic
958636283 3:96750778-96750800 TGGAATGATCAGCAGCAGAGAGG + Intergenic
962950169 3:140211166-140211188 CTCTGTGCTCAGTAGCAGAGTGG + Intronic
965677399 3:171212368-171212390 GGCTATGACCAGATGCAGTGGGG - Intronic
967865402 3:194186173-194186195 GGTTATGATCAGAAGTGGAGAGG + Intergenic
968988652 4:3893900-3893922 TGCAATGATTAGAAGCAGTGTGG - Intergenic
969247102 4:5942268-5942290 AGCTAAGATCAGGAGCAGGGTGG + Intronic
969965997 4:10996008-10996030 AGCTATGATCAGTTTCAGAGAGG - Intergenic
974028750 4:56757112-56757134 ATCTAAGATGAGAAGCAGAGAGG + Intergenic
975478743 4:74854242-74854264 AGCCATGAACAGGAGCAGAGGGG - Intergenic
976082991 4:81376595-81376617 CGTTAGGATGAGAAGCAGAATGG - Intergenic
978693888 4:111551970-111551992 CGTTATGACAGGAAGCAGAGTGG + Intergenic
979685788 4:123509095-123509117 CGGTTTAATCAGAAACAGAGGGG - Intergenic
984660962 4:182374996-182375018 TGGTATGATCAAAGGCAGAGAGG - Intronic
987448326 5:18049667-18049689 CACTATGATCGGAAGCAGAGTGG + Intergenic
992680132 5:79144978-79145000 TGGTATGATCAGAAAAAGAGGGG + Intronic
993861772 5:93145164-93145186 CGCATTGAGCAGAGGCAGAGTGG - Intergenic
993861779 5:93145214-93145236 CGCATTGAGCAGTAGCAGAGCGG - Intergenic
993861793 5:93145330-93145352 CGCATTGAGCAGAGGCAGAGTGG - Intergenic
995381679 5:111542249-111542271 CGGTAGGATCCAAAGCAGAGTGG - Intergenic
995651743 5:114377301-114377323 CCTTAGGATCAGAGGCAGAGTGG - Intronic
996330917 5:122327865-122327887 TGCTATAGTCAGAAGGAGAGAGG + Intronic
999232008 5:150067077-150067099 CAATGTGATCAGAAGCTGAGAGG - Intronic
1001803395 5:174562932-174562954 GGCTGTGGTCAGAAGGAGAGTGG + Intergenic
1002799296 6:505757-505779 GGCTATGATGAGAAGGAGAATGG - Intronic
1012988342 6:105898809-105898831 AGCTATTTTCAGAAGAAGAGTGG - Intergenic
1013249301 6:108318202-108318224 CGTTATGATAGGAAGCAGAGTGG + Intronic
1015450212 6:133358853-133358875 CACTATGAGAAGAAACAGAGGGG + Intronic
1018118597 6:160612993-160613015 CGCAATGCTCAGACGCAGAAGGG - Exonic
1018119197 6:160618545-160618567 CGCAATGCTCAGACGCAGAAGGG - Exonic
1018119800 6:160624091-160624113 CGCAATGCTCAGACGCAGAAGGG - Exonic
1018120401 6:160629635-160629657 CGCAATGCTCAGACGCAGAAGGG - Exonic
1018120996 6:160635184-160635206 CGCAATGCTCAGACGCAGAAGGG - Exonic
1018121599 6:160640728-160640750 CGCAATGCTCAGACGCAGAAGGG - Exonic
1018122201 6:160646275-160646297 CGCAATGCTCAGACGCAGAAGGG - Exonic
1018831361 6:167446111-167446133 AGCGTTGAACAGAAGCAGAGGGG - Intergenic
1019169639 6:170125598-170125620 GCCTCTGATCTGAAGCAGAGGGG + Intergenic
1020311495 7:6872014-6872036 TGCAATGATTAGAAGCAGTGTGG - Intergenic
1020397283 7:7730613-7730635 GGCTCAGATCAGGAGCAGAGAGG - Intronic
1020441128 7:8217865-8217887 CGATATGTTCAGAAGCAGTGGGG - Intronic
1021028620 7:15701613-15701635 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1024186586 7:46954567-46954589 AGCTATGATAAGAAGTAAAGAGG + Intergenic
1034187605 7:149191084-149191106 CGTTATGACAGGAAGCAGAGTGG - Intergenic
1035054698 7:156026754-156026776 CCCTATGAACAGAACCACAGTGG - Intergenic
1039816752 8:41101091-41101113 GGCTACGAGCAGAAGTAGAGAGG - Intergenic
1043038091 8:75224040-75224062 TCCCATGATCAGAAGAAGAGGGG + Intergenic
1043118240 8:76286849-76286871 GACGATGAGCAGAAGCAGAGTGG - Intergenic
1043701890 8:83299315-83299337 CCCCATGACCAGAAGCAGATGGG - Intergenic
1047478153 8:125255542-125255564 CAGTGTGATCACAAGCAGAGAGG + Intronic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1050546216 9:6711446-6711468 CTTTATGATCAAAAGCAGAGTGG - Intergenic
1050785732 9:9399357-9399379 TCCTATGATGAGAACCAGAGGGG - Intronic
1053787670 9:41663996-41664018 GGCAGTTATCAGAAGCAGAGAGG + Intergenic
1054157455 9:61650771-61650793 GGCAGTTATCAGAAGCAGAGAGG - Intergenic
1054175947 9:61875338-61875360 GGCAGTTATCAGAAGCAGAGAGG + Intergenic
1054477229 9:65581776-65581798 GGCAGTTATCAGAAGCAGAGAGG - Intergenic
1054661592 9:67705470-67705492 GGCAGTTATCAGAAGCAGAGAGG - Intergenic
1055089624 9:72349441-72349463 CCCTATGAACATATGCAGAGTGG - Intergenic
1059260241 9:112969222-112969244 CTCTATGTTCAAAAGAAGAGAGG - Intergenic
1060882463 9:127127508-127127530 GACTATGATCAGAAGCAGGGAGG - Intronic
1061935364 9:133854622-133854644 CGCTGTGACCAGAAGCAGGCTGG + Intronic
1203459144 Un_GL000220v1:17755-17777 CGTTCTGATCAGAAGCTGACAGG - Intergenic
1190459643 X:50659481-50659503 CGCTAGCATCAGCAGAAGAGTGG + Intronic
1192613551 X:72592835-72592857 AACTATGGCCAGAAGCAGAGAGG + Intronic
1195083454 X:101391763-101391785 CGTTATGACAGGAAGCAGAGTGG + Exonic