ID: 1079865248

View in Genome Browser
Species Human (GRCh38)
Location 11:25725797-25725819
Sequence AAATTCTACTAGATGTATAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079865248_1079865251 15 Left 1079865248 11:25725797-25725819 CCATTATACATCTAGTAGAATTT No data
Right 1079865251 11:25725835-25725857 TACTCCAAGACTTTTTTGGTTGG No data
1079865248_1079865250 11 Left 1079865248 11:25725797-25725819 CCATTATACATCTAGTAGAATTT No data
Right 1079865250 11:25725831-25725853 TGTCTACTCCAAGACTTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079865248 Original CRISPR AAATTCTACTAGATGTATAA TGG (reversed) Intergenic
No off target data available for this crispr