ID: 1079869521

View in Genome Browser
Species Human (GRCh38)
Location 11:25780588-25780610
Sequence GGGGTGGCTACACTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 6, 3: 24, 4: 237}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079869521_1079869535 27 Left 1079869521 11:25780588-25780610 CCCCAGCACAGTGTAGCCACCCC 0: 1
1: 0
2: 6
3: 24
4: 237
Right 1079869535 11:25780638-25780660 ATGTGGGTTCACTTCTTACTGGG No data
1079869521_1079869530 10 Left 1079869521 11:25780588-25780610 CCCCAGCACAGTGTAGCCACCCC 0: 1
1: 0
2: 6
3: 24
4: 237
Right 1079869530 11:25780621-25780643 TGGTAAGACTATTTCCCATGTGG No data
1079869521_1079869536 30 Left 1079869521 11:25780588-25780610 CCCCAGCACAGTGTAGCCACCCC 0: 1
1: 0
2: 6
3: 24
4: 237
Right 1079869536 11:25780641-25780663 TGGGTTCACTTCTTACTGGGTGG No data
1079869521_1079869531 11 Left 1079869521 11:25780588-25780610 CCCCAGCACAGTGTAGCCACCCC 0: 1
1: 0
2: 6
3: 24
4: 237
Right 1079869531 11:25780622-25780644 GGTAAGACTATTTCCCATGTGGG No data
1079869521_1079869524 -10 Left 1079869521 11:25780588-25780610 CCCCAGCACAGTGTAGCCACCCC 0: 1
1: 0
2: 6
3: 24
4: 237
Right 1079869524 11:25780601-25780623 TAGCCACCCCCATGAAAACGTGG 0: 1
1: 0
2: 0
3: 4
4: 74
1079869521_1079869534 26 Left 1079869521 11:25780588-25780610 CCCCAGCACAGTGTAGCCACCCC 0: 1
1: 0
2: 6
3: 24
4: 237
Right 1079869534 11:25780637-25780659 CATGTGGGTTCACTTCTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079869521 Original CRISPR GGGGTGGCTACACTGTGCTG GGG (reversed) Intergenic
900578938 1:3398503-3398525 GGGCTGGCTGCATTGAGCTGGGG - Intronic
901414143 1:9105399-9105421 GGGGTGCAGCCACTGTGCTGCGG + Intronic
901450972 1:9336951-9336973 GGGGCCGCTTCACAGTGCTGGGG + Intronic
902712067 1:18247289-18247311 TGGGTGCCTGGACTGTGCTGGGG + Intronic
903130724 1:21277976-21277998 AGGGTGGCCACGCTGCGCTGGGG - Intronic
904287208 1:29460411-29460433 GGGGTGACCTCACTGGGCTGTGG + Intergenic
905771483 1:40640674-40640696 GGGCTGGCTCCTCTGTGATGTGG + Intronic
906392227 1:45428568-45428590 GGGGAGGCTGCAGTGAGCTGAGG - Intronic
907412822 1:54294550-54294572 GGGGTGGCCTCACAGAGCTGGGG + Intronic
908930436 1:69311759-69311781 AGGGTTGCTACAGTTTGCTGGGG + Intergenic
909806116 1:79875747-79875769 GGGGCAGCTGCACTGTGCTGGGG - Intergenic
910513782 1:88036316-88036338 GAGGTGGCTGCACTGTGCTGGGG - Intergenic
912443121 1:109713573-109713595 TGGGTGGCTGCAATGTGCGGGGG + Intronic
915815645 1:158962408-158962430 GGGGTGGCTCCAGTGTGTTGGGG - Intronic
917585845 1:176425790-176425812 GAGGCGGCTGCTCTGTGCTGGGG + Intergenic
919737572 1:200962708-200962730 GGCTGGGCCACACTGTGCTGTGG + Intergenic
921183182 1:212647205-212647227 GGGGTGTGAACTCTGTGCTGGGG - Intergenic
922521392 1:226255392-226255414 GGGGTGGCTAGAGTGGGCTGGGG - Intronic
923109098 1:230876791-230876813 GGGGTGGCTGGCATGTGCTGAGG - Intergenic
924412376 1:243819609-243819631 GGAGGGGATGCACTGTGCTGGGG - Intronic
1064095018 10:12417725-12417747 GGAGTGGCTACACTCTTATGTGG + Intronic
1064370373 10:14747555-14747577 AGGGTGGCTGCAGTTTGCTGGGG + Intronic
1067750359 10:48967621-48967643 GGGGTGGTTCCACTGGGGTGGGG + Intronic
1069890023 10:71646834-71646856 GGGGTGACGAGACTGAGCTGAGG + Intronic
1069908876 10:71748086-71748108 GGGCTGGCCTGACTGTGCTGGGG - Exonic
1071230624 10:83580902-83580924 GGGCTGTGTCCACTGTGCTGAGG - Intergenic
1073546937 10:104357472-104357494 GGGGTGGCCACGGTGTGTTGAGG - Intronic
1073549122 10:104381080-104381102 GTGGAGGCTACAGTGAGCTGTGG + Intronic
1076117019 10:127907616-127907638 CGGGTGGCTACAGTGCGCGGGGG + Intronic
1077518116 11:3014483-3014505 GGGGTGCCTTCAGCGTGCTGTGG - Intronic
1078011406 11:7575826-7575848 GGGTGGGTCACACTGTGCTGTGG + Intronic
1078816162 11:14824033-14824055 GAGGTGGATACTCTGTGCTCGGG - Intronic
1078993136 11:16669710-16669732 GAGGTGGTTGCTCTGTGCTGGGG - Intronic
1079588008 11:22149869-22149891 GGTGGGGGTGCACTGTGCTGGGG + Intergenic
1079622159 11:22567655-22567677 AAGGTGGCTGCTCTGTGCTGGGG + Intergenic
1079869521 11:25780588-25780610 GGGGTGGCTACACTGTGCTGGGG - Intergenic
1082785552 11:57314363-57314385 GGAGTGGCTACAGCGTGCAGGGG + Intronic
1083263094 11:61533508-61533530 GGGGAGGCTCCACCGTGGTGTGG + Intronic
1086821976 11:91446051-91446073 GGGGCAGCTGCACTGTGCTGGGG - Intergenic
1092091719 12:5809242-5809264 AGGGTGGCTTCACATTGCTGTGG - Intronic
1092579197 12:9820565-9820587 GAGGTGGGTGCTCTGTGCTGAGG - Intergenic
1092994513 12:13935991-13936013 ACAGTGGCTGCACTGTGCTGAGG + Intronic
1093388114 12:18583587-18583609 GTGGTGGGTGCTCTGTGCTGGGG - Intronic
1093498123 12:19780236-19780258 GGGAGGGCTGCACTGTTCTGGGG + Intergenic
1093528663 12:20135490-20135512 GAGGTGGGTGCTCTGTGCTGGGG + Intergenic
1093690332 12:22102333-22102355 GGGGTTGTTGCTCTGTGCTGGGG + Intronic
1097637327 12:62138724-62138746 GGGGAGGCCAAACTTTGCTGGGG - Intronic
1098235278 12:68412283-68412305 GGCAAGGCTACACTATGCTGGGG - Intergenic
1098704124 12:73665445-73665467 GTGGTGGCGACACAGTGCTGGGG - Intergenic
1099709986 12:86211536-86211558 GAGATTGCTCCACTGTGCTGCGG + Intronic
1103822584 12:123710977-123710999 TGAGTGGCTACTATGTGCTGGGG + Intergenic
1103832334 12:123789711-123789733 GGGGTGGCTGCAATGTGGGGAGG + Intronic
1104256294 12:127142602-127142624 AGGGTGGCTGCAATTTGCTGGGG + Intergenic
1104617644 12:130283873-130283895 GGGGGGGCTCCTGTGTGCTGTGG + Intergenic
1104688762 12:130808264-130808286 GGGGTGGCCACACTGCTGTGAGG - Intronic
1107254126 13:38403093-38403115 GAGGTGGCTAAAGTATGCTGTGG + Intergenic
1111965030 13:94852134-94852156 GGGGTGGCTGCACCATGCAGTGG - Intergenic
1112449815 13:99498538-99498560 GCGGTGTCTACCCGGTGCTGGGG - Intergenic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1113956711 13:114103282-114103304 GGGCAGCCTTCACTGTGCTGAGG - Intronic
1114131799 14:19800739-19800761 GGGGTGGGGAGGCTGTGCTGTGG - Intronic
1114530086 14:23390003-23390025 GGGGAGGCTCCGCTGTGCAGGGG + Intronic
1114988768 14:28262634-28262656 GAGGTGGTTGCTCTGTGCTGAGG - Intergenic
1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG + Intronic
1121273145 14:92651242-92651264 GGGGTGACAACACTGTGCTCTGG - Intronic
1121731336 14:96189257-96189279 TGGGTGGCAGCTCTGTGCTGGGG + Intergenic
1122843118 14:104476338-104476360 GAGGTGGCTCCAGTGTGCAGTGG - Intronic
1123068869 14:105631374-105631396 GGGGAGTCTGCACTGGGCTGGGG + Intergenic
1123073025 14:105651332-105651354 GGGGAGTCTGCACTGGGCTGGGG + Intergenic
1123092947 14:105750102-105750124 GGGGAGTCTGCACTGGGCTGGGG + Intergenic
1123107518 14:105849657-105849679 GGGGAGTCTGCACTGGGCTGGGG - Intergenic
1123975416 15:25548985-25549007 GGGGTAGCTCCTCTGTACTGTGG - Intergenic
1126067886 15:44839798-44839820 GGGCAGGCCACACTGGGCTGTGG - Intergenic
1126091941 15:45060777-45060799 GGGCAGGCCACACTGGGCTGTGG + Intronic
1128306387 15:66601493-66601515 GGGGTGGGGGCACTGTTCTGAGG + Intronic
1130539366 15:84811166-84811188 GGGTTGTCTAGACAGTGCTGAGG + Intergenic
1131544187 15:93302187-93302209 TGGGTGGCTACCATGTGCTGAGG - Intergenic
1132570129 16:640939-640961 TGGGGGGCTACTCTGTGCTGTGG - Intronic
1132768978 16:1550576-1550598 GGGGTGGCTCCACACTGCTAGGG + Intronic
1132771921 16:1568204-1568226 GGGGTGGCCTCACCTTGCTGGGG + Exonic
1133130782 16:3675018-3675040 GGGGTGGCTGCACAGCTCTGTGG + Intronic
1133368750 16:5232035-5232057 TGGGTGCCTACACTGTGTGGGGG - Intergenic
1134121639 16:11588030-11588052 GGGCTGGGGACACTTTGCTGAGG - Intronic
1134817653 16:17219211-17219233 GTGGAGGCTGCAGTGTGCTGAGG + Intronic
1134826732 16:17290847-17290869 GAGGTGGTTACAATGTCCTGGGG + Intronic
1135353493 16:21750125-21750147 GGGCTGGGTGCACTGTGCAGTGG + Intronic
1135509033 16:23066009-23066031 GCGGTGGCTACACACTGATGGGG + Exonic
1136776437 16:32874252-32874274 AGGGTGGGAGCACTGTGCTGCGG - Intergenic
1136894178 16:33987260-33987282 AGGGTGGGAGCACTGTGCTGCGG + Intergenic
1137550634 16:49435143-49435165 GTGGTCGCCCCACTGTGCTGTGG - Intergenic
1138559386 16:57791515-57791537 CAGGTTGCTACACTGTGCTTGGG + Intronic
1139955323 16:70690409-70690431 GGACTTGCCACACTGTGCTGTGG - Intronic
1140376247 16:74447719-74447741 GGTTTGGGAACACTGTGCTGGGG + Intergenic
1142283751 16:89162549-89162571 GGTGCGGCTGCACCGTGCTGTGG + Intergenic
1203078852 16_KI270728v1_random:1136361-1136383 AGGGTGGGAGCACTGTGCTGCGG - Intergenic
1144764671 17:17725868-17725890 GGGGCGGCTAGACTGTGTTCAGG + Intronic
1144948990 17:18984019-18984041 GGGGGGGATTCACTCTGCTGAGG - Intronic
1148145771 17:45363940-45363962 GGAGAGGCTATAGTGTGCTGAGG - Intergenic
1150234067 17:63578294-63578316 GTGGAGGCTGCACTGAGCTGTGG + Intronic
1150691434 17:67370655-67370677 GTGGTGGCTACAGTGAGCTGAGG - Intergenic
1152259773 17:79260635-79260657 GGTGTGGCCACACTGGCCTGAGG + Intronic
1152763663 17:82123085-82123107 GGAGTGGTTAAACTGTGCAGTGG - Intronic
1153424233 18:4945102-4945124 GGGGCGGCTGCACTGGGCTGGGG - Intergenic
1153537159 18:6114897-6114919 GGGGTGGAGACACAGTGCTTTGG + Intronic
1153931841 18:9885992-9886014 AAGGTGGCTCCCCTGTGCTGAGG - Exonic
1154454826 18:14511042-14511064 AGGGTGGCTGTTCTGTGCTGAGG + Intronic
1155044415 18:22091306-22091328 GGGGGGGCTAGACAGTGCTGTGG + Intronic
1156352280 18:36311679-36311701 GGAGTGGGGACACTGTGGTGGGG - Intronic
1157608343 18:48940126-48940148 GGGGAGGGTACACTGTTTTGGGG - Intronic
1160892725 19:1387772-1387794 GGGGTGGGAACAGTGAGCTGCGG - Intronic
1162524462 19:11199378-11199400 GGGGTGACCACACTGTACTTGGG - Exonic
1166880352 19:45925838-45925860 GGGGTGTCAACACTGTTCTTGGG + Intergenic
1167461318 19:49625978-49626000 GGGGTGGCTTCAGAGAGCTGGGG + Exonic
1167804226 19:51768714-51768736 CTGCTGGCTACACTGTTCTGCGG + Exonic
1167806432 19:51789519-51789541 CAGGTGGCTACACTGTTCTGAGG + Intronic
1168314949 19:55480963-55480985 AGGGTGGCCACAGTTTGCTGGGG + Intronic
925079977 2:1056238-1056260 GGAGAGGCCGCACTGTGCTGTGG + Intronic
925132618 2:1504225-1504247 GGGGCGTCTGCGCTGTGCTGGGG + Intronic
925646800 2:6044472-6044494 GAGGTGACTGCTCTGTGCTGGGG - Intergenic
927038450 2:19204414-19204436 GGGGAAGCCACACTGTGCTCAGG + Intergenic
928504867 2:31940610-31940632 GGGGAGGCTACAGTGAGCTATGG - Intronic
929023691 2:37578725-37578747 CGGGTGGGAACACTGTGCTGTGG - Intergenic
929460210 2:42097758-42097780 GGAGAGGCTACACTGGGTTGGGG - Intergenic
930455692 2:51605423-51605445 GGAGTGGGTGCACTGTGCTAGGG + Intergenic
933436445 2:82256545-82256567 AGGGTGGCTGCAGTTTGCTGGGG + Intergenic
934856787 2:97734761-97734783 GGAGTGGCTTCACCGGGCTGTGG + Intronic
935012798 2:99151393-99151415 GCGGAGGCTGCACTGAGCTGAGG + Exonic
935490818 2:103717494-103717516 GAGGAGGGTACTCTGTGCTGGGG - Intergenic
936255556 2:110907611-110907633 GGGGTGGTTAGACTGTGCCTGGG + Intronic
937226705 2:120374540-120374562 GGATGGGCTACTCTGTGCTGGGG - Intergenic
941266486 2:163369063-163369085 TGGGTAGCTACACTGTGATAAGG - Intergenic
947833228 2:233156629-233156651 GGAGTGGCTCCACTCTTCTGTGG + Intronic
948674832 2:239591151-239591173 CCGGTGGCCACAGTGTGCTGGGG - Intergenic
948732116 2:239972315-239972337 GGGTGGGCTTCACTCTGCTGGGG + Intronic
1169025770 20:2370017-2370039 AGGGTGACTACACAGGGCTGTGG + Intergenic
1169607607 20:7340163-7340185 GTGGTGGCTGCACTGGGTTGGGG - Intergenic
1171988231 20:31675671-31675693 GGGGTGGCAAGACTGTGTTGGGG + Intronic
1176065746 20:63193640-63193662 GCGGAGGTTACACTGAGCTGAGG + Intergenic
1176307742 21:5133012-5133034 GGTGTGGCTGCCCTGAGCTGTGG - Intronic
1176370264 21:6058152-6058174 ACGGTGGCCACACGGTGCTGCGG - Intergenic
1176819339 21:13642266-13642288 AGGGTGGCTGTTCTGTGCTGAGG - Intergenic
1177989272 21:28018778-28018800 GGGCTTTCTACACTCTGCTGAGG - Intergenic
1179753255 21:43480389-43480411 ACGGTGGCCACACGGTGCTGCGG + Intergenic
1179849319 21:44129018-44129040 GGTGTGGCTGCCCTGAGCTGTGG + Intronic
1180072735 21:45444532-45444554 AGGGTGGTTCCACAGTGCTGTGG + Intronic
1181157301 22:20931337-20931359 GTGGAGGCTACAGTGAGCTGTGG + Intronic
1181860239 22:25812597-25812619 TGGGTGGCTTCTCTGTGCAGAGG + Intronic
1182153755 22:28049705-28049727 GGGGTGTCTACAGTGTGGTAAGG + Intronic
1183060702 22:35334811-35334833 GGGGTGGAGACACTGTGTTTTGG - Intronic
1184180627 22:42822070-42822092 GGGGCAGCAACACTCTGCTGAGG - Intronic
1185284294 22:49993460-49993482 GCGGTGGGTGCACTGGGCTGTGG + Intergenic
949111996 3:272240-272262 GGGGTGCCTACTCTGTGCAGGGG + Intronic
950119322 3:10471181-10471203 GCGCTGGAGACACTGTGCTGGGG - Intronic
950574547 3:13823989-13824011 GGGCTGGCTACACTGGGGAGTGG - Intronic
950947082 3:16960297-16960319 AGTGTGGCGGCACTGTGCTGGGG - Intronic
950995749 3:17494439-17494461 GGAGTGGGTGCACTGTGCTGGGG + Intronic
951613816 3:24521273-24521295 AGACTGGCTACACTGTCCTGGGG - Intergenic
952212426 3:31241671-31241693 GTGCTGGCTACACTCTGCAGGGG - Intergenic
952965082 3:38616188-38616210 GTGCTGGGGACACTGTGCTGGGG - Intronic
953115712 3:39990245-39990267 GTGGTGGCTACACAGGGCAGAGG - Intronic
953405023 3:42655710-42655732 GGGGTGGCTGAACCCTGCTGAGG + Intronic
953850731 3:46463977-46463999 GTGGAGGCTGCACTGGGCTGGGG + Intronic
955604934 3:60691434-60691456 GTGGAGGCTACAGTGAGCTGTGG - Intronic
956578214 3:70779654-70779676 GGTGAGGCTAAGCTGTGCTGTGG - Intergenic
958478999 3:94622596-94622618 GTGGAGGCTGCAGTGTGCTGAGG + Intergenic
958838246 3:99171748-99171770 GGGTTGGCTACACTGTGCAGGGG - Intergenic
959421598 3:106135714-106135736 GGGGAGGCTGCAGTGTGCGGAGG - Intergenic
959441389 3:106379579-106379601 GTGGTGACTAAACTGTGTTGAGG + Intergenic
960052639 3:113252749-113252771 GGAGTGGCTCCACTGTGAGGGGG - Intronic
960218938 3:115079890-115079912 AGAGTGCCTACAATGTGCTGGGG + Intronic
960758721 3:121049178-121049200 AAGGTGGCTGCACTGTGCTAGGG + Intronic
960833182 3:121873366-121873388 GGAGTGGCTACACTGTAAAGAGG - Intronic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
966151944 3:176875244-176875266 AGAGTTGCTGCACTGTGCTGGGG + Intergenic
966454865 3:180102988-180103010 AGGGTTGCTGCAGTGTGCTGGGG - Intergenic
968891594 4:3372235-3372257 GGGGTGGCCGCTCTGGGCTGGGG + Intronic
969633892 4:8353998-8354020 GGGGTGGATACACAATGATGGGG + Intergenic
970230708 4:13907769-13907791 GGGGAGGCTGTGCTGTGCTGGGG + Intergenic
977002305 4:91519216-91519238 AGGGCGGCCACACTGTACTGGGG + Intronic
977039844 4:92002278-92002300 GGAGTGGGTGCACTGCGCTGGGG - Intergenic
979863459 4:125723605-125723627 GCGGTGGCTGCACAGTGATGGGG + Intergenic
980148197 4:129015255-129015277 GGGGTGGCTGCAGTGTGTGGAGG + Intronic
980517008 4:133877199-133877221 GAGGTGGGTGCTCTGTGCTGGGG + Intergenic
982638999 4:157933359-157933381 TGGGTGATTACACTGTTCTGTGG - Intergenic
983217628 4:165016862-165016884 GGGGTCTCTACAGTGTCCTGGGG + Intergenic
984432314 4:179664807-179664829 GGGGTAGCCCCACTCTGCTGGGG + Intergenic
985586870 5:744801-744823 GTGGCGGCTACAATGAGCTGAGG + Intronic
986606486 5:9528418-9528440 TGGGTGGGGAGACTGTGCTGAGG - Intronic
987644199 5:20648132-20648154 GAGGCGGCTGCCCTGTGCTGAGG - Intergenic
990627269 5:57628311-57628333 GGGGTGGCTATCCTGTGCATTGG - Intergenic
992725566 5:79603688-79603710 GAGGAGGCTACGCTCTGCTGGGG + Intergenic
993794399 5:92249105-92249127 GGGGTGGCTATGCTGTGTTGGGG - Intergenic
995271143 5:110220595-110220617 AGGGCTGCTTCACTGTGCTGGGG + Intergenic
996901925 5:128552326-128552348 GGGGCTGCTACAGTTTGCTGAGG - Intronic
997524744 5:134544914-134544936 GGGGTGGCCAGATTGTGTTGGGG + Intronic
999264130 5:150255473-150255495 GGGGTGGGTACACCCTGCAGGGG + Intronic
1001931779 5:175678231-175678253 CGGGTGAAGACACTGTGCTGGGG - Intronic
1003240433 6:4340807-4340829 GGGGAGGCTTCACTATTCTGAGG - Intergenic
1004806779 6:19211337-19211359 GGGTTGGGCACACTGTGCGGGGG + Intergenic
1005348513 6:24912228-24912250 GGAGTGCCTGCTCTGTGCTGGGG - Intronic
1008061551 6:47002824-47002846 GGGGTCCATACAGTGTGCTGTGG + Intronic
1010019094 6:71139166-71139188 GAGGTGGTTGCTCTGTGCTGGGG - Intergenic
1010495885 6:76533246-76533268 GGGGTGGCTGCACTGTCCTAGGG + Intergenic
1010495938 6:76533506-76533528 GGGGCAGCTGCACTGTACTGGGG + Intergenic
1012252218 6:96991900-96991922 AAGGTGGCTGCGCTGTGCTGGGG + Intronic
1013311476 6:108898521-108898543 GAGGTGGCTTTGCTGTGCTGAGG - Intronic
1014975407 6:127875381-127875403 GGGGTTTCTACATTGTGTTGAGG - Intronic
1015156537 6:130102621-130102643 GGGTTGGCTAGAGTGTGATGGGG - Intronic
1018180482 6:161218632-161218654 GATGTGGATACACTGTGCTAGGG - Intronic
1019354243 7:570574-570596 AGGGTGACTGCCCTGTGCTGTGG + Intronic
1020133710 7:5574416-5574438 GGGGTGACTAAGCTGTCCTGGGG - Intergenic
1021355605 7:19650735-19650757 GGGGTGGCTTCACTGTGCTAGGG - Intergenic
1022522392 7:31016614-31016636 AGGGAGGAGACACTGTGCTGAGG + Intergenic
1023989114 7:45117636-45117658 GGGCTGGGTCCACTGGGCTGTGG - Intergenic
1024234076 7:47384717-47384739 GCTGTGACTCCACTGTGCTGAGG - Intronic
1026281180 7:68923007-68923029 GGGGTGGCCAGAGTGTGCTCAGG - Intergenic
1027866352 7:83652387-83652409 GGAGAGGCTACGCTCTGCTGTGG - Intergenic
1031061065 7:117051935-117051957 TGGGTGGCTAGACTCTGCTAAGG - Intronic
1035472648 7:159120004-159120026 GGGGAGGGGACAGTGTGCTGGGG + Intronic
1035901078 8:3459198-3459220 GTGGTGGCTGCACCGTGGTGGGG + Intronic
1039495365 8:37976195-37976217 GTGGAGGCTGCAGTGTGCTGAGG - Intergenic
1040404771 8:47088857-47088879 AGGGTGGCTGTGCTGTGCTGGGG + Intergenic
1040447947 8:47515095-47515117 GGCTGGGCCACACTGTGCTGTGG + Intronic
1041012620 8:53559245-53559267 AGGGCGGCTGCACTGCGCTGGGG - Intergenic
1044294891 8:90516604-90516626 GTGGAGGTTACACTGAGCTGAGG + Intergenic
1044573402 8:93743907-93743929 ATGGTGGCTGCACTGAGCTGTGG + Intergenic
1045263902 8:100602928-100602950 GGGGGGCCTACTCTGTTCTGTGG + Intronic
1046255773 8:111694539-111694561 AGGGTGGCTGTTCTGTGCTGGGG + Intergenic
1047047611 8:121072552-121072574 GGGTTGGGTACAGTGTGTTGTGG + Intergenic
1047846692 8:128813922-128813944 GGAGTGGCTTTTCTGTGCTGGGG + Intergenic
1048133576 8:131723706-131723728 AGGGTGGCTACAAAGTGATGAGG + Intergenic
1049605527 8:143527450-143527472 GGTGGTGCTGCACTGTGCTGTGG - Intronic
1050131041 9:2412978-2413000 GAAGTGTTTACACTGTGCTGGGG - Intergenic
1052387108 9:27835396-27835418 GGAGGGGCTGCGCTGTGCTGGGG + Intergenic
1055373503 9:75624915-75624937 GAGGTGGCTGCACTGTGATGGGG + Intergenic
1055495966 9:76856192-76856214 GGGCTCACTGCACTGTGCTGTGG - Intronic
1056489231 9:87088438-87088460 GGGCTGGCTGCACTTGGCTGGGG - Intergenic
1057294923 9:93829375-93829397 GAGGTGGCAGCACAGTGCTGAGG + Intergenic
1060791248 9:126487052-126487074 GGGGTGGCCACACTGTGACTCGG - Intronic
1061074217 9:128331401-128331423 GGGGTGGCCTCTCTGTGGTGGGG + Intronic
1062521642 9:136960371-136960393 GGGGTGGGGACACTGTGGGGTGG + Intergenic
1062521704 9:136960598-136960620 GGGGTGGGTAGAATGTTCTGTGG + Intergenic
1062699738 9:137892655-137892677 CGGGAGGCTGCCCTGTGCTGGGG - Intronic
1203528019 Un_GL000213v1:107304-107326 AGGGTGGCTGTTCTGTGCTGAGG + Intergenic
1187527404 X:20066602-20066624 GGGGTGGCTGGAATGAGCTGAGG - Intronic
1188532412 X:31156909-31156931 GGGGTGGCTACAATGTGGCTAGG - Intronic
1190874375 X:54449308-54449330 GGGCTGGCTGGACTGGGCTGGGG - Intronic
1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG + Intergenic
1191654711 X:63584254-63584276 TGGCTGGCTCCACTGTGATGAGG + Intergenic
1192055508 X:67769296-67769318 GAGGTGGTTGCTCTGTGCTGGGG - Intergenic
1192691840 X:73373048-73373070 GGGATGGCTGCCCTGTGCAGGGG + Intergenic
1192760214 X:74088559-74088581 GGGGTGGCTGCATTTTGCTCAGG - Intergenic
1193164286 X:78263879-78263901 GGAGGGGGTGCACTGTGCTGGGG + Intergenic
1193533593 X:82686353-82686375 GGAGGGGTTGCACTGTGCTGTGG + Intergenic
1193985711 X:88238126-88238148 AGGGCGGCTATACTGTGCTAGGG + Intergenic
1194040703 X:88938665-88938687 GGGGTGGTGTGACTGTGCTGTGG + Intergenic
1194195175 X:90883360-90883382 GGGAAGGCTGCACTGTGCTGGGG + Intergenic
1194539745 X:95156099-95156121 GGGGTGGCTGCATTGTACTGGGG - Intergenic
1194539787 X:95156365-95156387 GGGGTGGCTGCATTCTGCTAGGG - Intergenic
1194948033 X:100091769-100091791 AGGGTTGCTACAGTATGCTGGGG - Intergenic
1195208266 X:102625501-102625523 GGAGTAGCTGCACTGTGCTGAGG + Intergenic
1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG + Intergenic
1197402264 X:126006428-126006450 GAGATGGTTACACTGTGCTGGGG - Intergenic
1198089221 X:133311394-133311416 GGCATGGGTACACTGGGCTGTGG + Exonic
1200103425 X:153699788-153699810 AGGGTGGAAGCACTGTGCTGCGG + Intergenic
1201410965 Y:13699181-13699203 GTGGAGGCTACAGTGAGCTGTGG - Intergenic
1201426750 Y:13859724-13859746 GGGGAGGCTGCAGTGGGCTGAGG - Intergenic