ID: 1079870029

View in Genome Browser
Species Human (GRCh38)
Location 11:25785693-25785715
Sequence ATTATGTTCTTGTGGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079870029_1079870031 9 Left 1079870029 11:25785693-25785715 CCTTTTTTCCACAAGAACATAAT No data
Right 1079870031 11:25785725-25785747 CTTCTTCTTAGAGTATTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079870029 Original CRISPR ATTATGTTCTTGTGGAAAAA AGG (reversed) Intergenic
No off target data available for this crispr