ID: 1079876452

View in Genome Browser
Species Human (GRCh38)
Location 11:25863604-25863626
Sequence CCAATTTGATATTGTTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079876452_1079876454 23 Left 1079876452 11:25863604-25863626 CCTTTGAAACAATATCAAATTGG No data
Right 1079876454 11:25863650-25863672 AAAAAAAAAAACAACAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079876452 Original CRISPR CCAATTTGATATTGTTTCAA AGG (reversed) Intergenic
No off target data available for this crispr