ID: 1079876454

View in Genome Browser
Species Human (GRCh38)
Location 11:25863650-25863672
Sequence AAAAAAAAAAACAACAACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079876451_1079876454 28 Left 1079876451 11:25863599-25863621 CCACACCTTTGAAACAATATCAA No data
Right 1079876454 11:25863650-25863672 AAAAAAAAAAACAACAACATTGG No data
1079876452_1079876454 23 Left 1079876452 11:25863604-25863626 CCTTTGAAACAATATCAAATTGG No data
Right 1079876454 11:25863650-25863672 AAAAAAAAAAACAACAACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079876454 Original CRISPR AAAAAAAAAAACAACAACAT TGG Intergenic
No off target data available for this crispr