ID: 1079876906

View in Genome Browser
Species Human (GRCh38)
Location 11:25869988-25870010
Sequence ATGTAGAAGTTGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079876904_1079876906 17 Left 1079876904 11:25869948-25869970 CCACACATATCTACTCTTACACA No data
Right 1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079876906 Original CRISPR ATGTAGAAGTTGATGGAAGA TGG Intergenic
No off target data available for this crispr