ID: 1079892809

View in Genome Browser
Species Human (GRCh38)
Location 11:26079430-26079452
Sequence CTATATAACCTGATGGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079892809_1079892813 -10 Left 1079892809 11:26079430-26079452 CCAAGCACCATCAGGTTATATAG No data
Right 1079892813 11:26079443-26079465 GGTTATATAGGTCAAGTAATGGG No data
1079892809_1079892814 3 Left 1079892809 11:26079430-26079452 CCAAGCACCATCAGGTTATATAG No data
Right 1079892814 11:26079456-26079478 AAGTAATGGGAAAGAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079892809 Original CRISPR CTATATAACCTGATGGTGCT TGG (reversed) Intergenic
No off target data available for this crispr