ID: 1079895092

View in Genome Browser
Species Human (GRCh38)
Location 11:26109101-26109123
Sequence CTGCAAACACAGAGGAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079895088_1079895092 11 Left 1079895088 11:26109067-26109089 CCGGTGAAAGGAAGAATGTTTTG No data
Right 1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG No data
1079895086_1079895092 25 Left 1079895086 11:26109053-26109075 CCAGAAAGTCTAATCCGGTGAAA No data
Right 1079895092 11:26109101-26109123 CTGCAAACACAGAGGAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079895092 Original CRISPR CTGCAAACACAGAGGAACCA GGG Intergenic
No off target data available for this crispr