ID: 1079902460

View in Genome Browser
Species Human (GRCh38)
Location 11:26204311-26204333
Sequence GTGTTGTCCTGGGGGATAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079902460_1079902468 14 Left 1079902460 11:26204311-26204333 CCACTTATCCCCCAGGACAACAC No data
Right 1079902468 11:26204348-26204370 CAACACATTCTAGAAGGGCAAGG No data
1079902460_1079902465 8 Left 1079902460 11:26204311-26204333 CCACTTATCCCCCAGGACAACAC No data
Right 1079902465 11:26204342-26204364 TACCTGCAACACATTCTAGAAGG No data
1079902460_1079902466 9 Left 1079902460 11:26204311-26204333 CCACTTATCCCCCAGGACAACAC No data
Right 1079902466 11:26204343-26204365 ACCTGCAACACATTCTAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079902460 Original CRISPR GTGTTGTCCTGGGGGATAAG TGG (reversed) Intergenic
No off target data available for this crispr