ID: 1079909686

View in Genome Browser
Species Human (GRCh38)
Location 11:26294252-26294274
Sequence ATGGCTCTCTAACAGTCTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079909686_1079909687 -10 Left 1079909686 11:26294252-26294274 CCGTAAGACTGTTAGAGAGCCAT No data
Right 1079909687 11:26294265-26294287 AGAGAGCCATTGAGCTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079909686 Original CRISPR ATGGCTCTCTAACAGTCTTA CGG (reversed) Intergenic
No off target data available for this crispr