ID: 1079910028

View in Genome Browser
Species Human (GRCh38)
Location 11:26298409-26298431
Sequence ACAACAGAAGTCCCTACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079910026_1079910028 25 Left 1079910026 11:26298361-26298383 CCTGTATATTTTAAGCTAACAAA No data
Right 1079910028 11:26298409-26298431 ACAACAGAAGTCCCTACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079910028 Original CRISPR ACAACAGAAGTCCCTACACA TGG Intergenic
No off target data available for this crispr