ID: 1079916588

View in Genome Browser
Species Human (GRCh38)
Location 11:26375375-26375397
Sequence GAGTTAAGGACCTTGGTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 205}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079916580_1079916588 22 Left 1079916580 11:26375330-26375352 CCCGGTTCCTAACAGACCATGGA 0: 16
1: 237
2: 671
3: 1125
4: 1290
Right 1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1079916583_1079916588 6 Left 1079916583 11:26375346-26375368 CCATGGACCAGTACCAGTCTGTT 0: 1
1: 44
2: 99
3: 319
4: 733
Right 1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1079916581_1079916588 21 Left 1079916581 11:26375331-26375353 CCGGTTCCTAACAGACCATGGAC 0: 16
1: 241
2: 524
3: 762
4: 780
Right 1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1079916582_1079916588 15 Left 1079916582 11:26375337-26375359 CCTAACAGACCATGGACCAGTAC 0: 7
1: 142
2: 334
3: 723
4: 985
Right 1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1079916584_1079916588 -1 Left 1079916584 11:26375353-26375375 CCAGTACCAGTCTGTTTTCTCAG 0: 1
1: 0
2: 0
3: 19
4: 353
Right 1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG 0: 1
1: 0
2: 0
3: 19
4: 205
1079916585_1079916588 -7 Left 1079916585 11:26375359-26375381 CCAGTCTGTTTTCTCAGAGTTAA 0: 1
1: 0
2: 2
3: 37
4: 263
Right 1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG 0: 1
1: 0
2: 0
3: 19
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079916588 Original CRISPR GAGTTAAGGACCTTGGTATA AGG Intronic
906195101 1:43925340-43925362 GACTTCAGGACCTTGGTTCAGGG + Intronic
906890536 1:49708457-49708479 AAGTTAAGAACCTTGATAAAAGG - Intronic
909128100 1:71700809-71700831 ATGTTAAGGACCTTGAGATAAGG + Intronic
910047583 1:82936504-82936526 AGGTTAAGGATCTTGATATAGGG - Intergenic
910912668 1:92254004-92254026 GAGCTAAGAACCTTGATAAAAGG + Intronic
916347829 1:163814274-163814296 GAGTTAAGGACTTGGGGAGAGGG - Intergenic
916813018 1:168322215-168322237 GACTTAAGTACCTGGGTAAATGG - Intergenic
918160164 1:181890615-181890637 AAGCTAAGAACCTTGATATAAGG + Intergenic
919289182 1:195606848-195606870 GTGTTAAGGCCCTTTGCATAAGG - Intergenic
924322025 1:242860041-242860063 AAGATAAGGACCTTGGGATGAGG + Intergenic
1063309594 10:4939889-4939911 GAGGTTAGGACCTTGTGATAGGG - Intronic
1063600058 10:7473046-7473068 GAGTTAAGGAACTTGATATGGGG - Intergenic
1064537790 10:16375957-16375979 GAGTCAAGGAACTTTGAATATGG + Intergenic
1067894325 10:50162748-50162770 GAGTTGAGGAGCGTGGTAGAAGG - Intergenic
1067954517 10:50777513-50777535 GAGTTGAGGAGCGTGGTAGAAGG + Intronic
1069223175 10:65908962-65908984 GATTTAAGGAATTTGGTTTAGGG - Intergenic
1069417567 10:68214491-68214513 GACTCAAGGAACTTGGTATAAGG - Intergenic
1072753800 10:98003627-98003649 AAGTTAAAGACCTTGGAATGGGG - Intronic
1075694122 10:124420654-124420676 GAGAGAGTGACCTTGGTATAGGG - Intergenic
1079303864 11:19305312-19305334 AAGTTAAGGACCTTGAGATGAGG - Intergenic
1079916588 11:26375375-26375397 GAGTTAAGGACCTTGGTATAAGG + Intronic
1079935119 11:26607838-26607860 AAGCTAAGAACCTTGGTAAAAGG - Intronic
1080135246 11:28846355-28846377 GAGCTAAGGACATTGTTAGAAGG - Intergenic
1081221725 11:40470623-40470645 AAGCTAAGAACCTTGATATAAGG + Intronic
1083384124 11:62295179-62295201 CAGTTAAGGATCTTGAGATAGGG + Intergenic
1084692716 11:70736391-70736413 GAGTTAAGGATCTTGGGATGAGG + Intronic
1086027573 11:82313172-82313194 AAGTTAAGGACTTTGGAATGTGG - Intergenic
1087374932 11:97327849-97327871 CAGTTAAGGATCTTGGGATGGGG - Intergenic
1088266960 11:107997075-107997097 AAGTTAAGGATCTTGGGATGGGG + Intergenic
1088560518 11:111110856-111110878 AAGTTAAGGATCTTGAGATAGGG + Intergenic
1089939088 11:122396838-122396860 AAGTTAAGGATCTTGAAATAGGG - Intergenic
1094275463 12:28669672-28669694 AAGTTAAGAACCTTGATAAAAGG + Intergenic
1095149952 12:38781800-38781822 GAGTTAAGGATTTGGGTAGAAGG - Intronic
1096048994 12:48589860-48589882 AAGTTAAATACCTTGGAATATGG + Intergenic
1096683127 12:53270088-53270110 GAGTTAAGGACCTGGAGGTAGGG + Intronic
1098936083 12:76480896-76480918 AGGTTAAGGATCTTGATATAGGG + Intronic
1098958581 12:76714232-76714254 AAGTTAAGGATCTTGAGATAGGG - Intergenic
1099042819 12:77676858-77676880 AAGTTAAGGACCTAGGGTTAGGG + Intergenic
1101128684 12:101666236-101666258 GAGTGCAGGCCCTTGGGATAAGG - Intronic
1102362507 12:112300558-112300580 GACTGAAGGACGTTGGTATCTGG - Intronic
1105023737 12:132835085-132835107 GAATTAAGGACCTTGAGATGAGG - Intronic
1106142951 13:27026290-27026312 AAGTTAAGGACCTTGCAATAAGG + Intergenic
1110045346 13:70821631-70821653 AAGTTAAGGACCTTGAGATGAGG - Intergenic
1110109917 13:71733050-71733072 TTTTTAAGGACCTTGCTATATGG - Intronic
1110389850 13:74960705-74960727 AAGCTAAGAACCTTGATATAAGG + Intergenic
1111482851 13:88854622-88854644 GAGTGATGGACCTTGTTATAAGG + Intergenic
1112566998 13:100560483-100560505 GAGTTAAGCTCCTGGGTAAAGGG - Intronic
1112686316 13:101832032-101832054 AAGTTAAGGATCTTGGCATTGGG + Intronic
1115359874 14:32488727-32488749 GAGTGAAGGACCGTGCTATCTGG - Intronic
1117254908 14:53967910-53967932 GAGTTAAAGACCTTGAGACAGGG - Intergenic
1117495885 14:56303255-56303277 GAGTTAAGGAAAGTGGAATAAGG + Intergenic
1118365551 14:65092539-65092561 CAGGTAAGTACCTTGGTTTAAGG + Intronic
1119045270 14:71313450-71313472 AAGTTAAGGATCTTGAGATAGGG - Intergenic
1120039647 14:79738208-79738230 AAGTTAAGGACCTTGAGATGAGG + Intronic
1120573190 14:86147473-86147495 AAATTAAGGATCTTGGAATAGGG - Intergenic
1120975052 14:90241021-90241043 GAGTTAAAGGCCCTGGTATCTGG + Intergenic
1126305097 15:47246738-47246760 GAGTTAAGGACATTGAGTTAGGG - Intronic
1127007510 15:54586777-54586799 GAGTGAAGGCCCTTGGCTTAAGG + Intronic
1131565399 15:93480755-93480777 GAGTTAAAGACCTTTGCCTAAGG - Intergenic
1131820690 15:96270759-96270781 GAGTTAAAGACCTGGGGACAAGG - Intergenic
1133092119 16:3412772-3412794 AAGTTAAGGATCTTGAGATAGGG - Intronic
1137225409 16:46501261-46501283 GAGCTAAGGCTCTTAGTATATGG - Intergenic
1137909280 16:52359887-52359909 CAGTTTTGGAACTTGGTATAGGG + Intergenic
1137975590 16:53028793-53028815 AAGTTAAGGATCTTGACATAGGG + Intergenic
1138248620 16:55485400-55485422 GAGCTATGGACCTTGGGAGAAGG + Exonic
1139505361 16:67395756-67395778 GAGGTAAGGACCTGGGGATGGGG - Intronic
1140831989 16:78760396-78760418 AAGTTAAGGACCTTGATATGGGG - Intronic
1141510627 16:84509691-84509713 GAGTTAAGGACTTTGAAATGAGG + Intronic
1141763402 16:86043694-86043716 GGGTTAAGGACCTTGCAATGGGG + Intergenic
1143859219 17:9875796-9875818 GAGTTAAGGCCCTTTATCTAGGG - Intronic
1144213727 17:13036396-13036418 GAGTTAAGGGTCTTGCTATGAGG - Intergenic
1144304217 17:13952623-13952645 GAGCCAAGAACCTTGGCATAAGG + Intergenic
1145803729 17:27711534-27711556 GAGTTAAGAACCTCTGTATCAGG - Intergenic
1148025702 17:44586132-44586154 GGATTAAGGACCTTGGTCAAGGG - Intergenic
1148657042 17:49292886-49292908 GAGTTAAGCCCATTGGAATATGG + Intronic
1149365590 17:55940215-55940237 AAGTTAAGAACCTTGATAAAAGG + Intergenic
1150063825 17:62091991-62092013 GGGTTAAGGACCTTGACATGGGG + Intergenic
1151179199 17:72313474-72313496 GAGTTCTTGACCTTGGTATATGG - Intergenic
1156571073 18:38253947-38253969 AATTTAAGGACCTTGAGATAAGG + Intergenic
1159263820 18:66052497-66052519 GAGTTAAGGGCAATAGTATAAGG - Intergenic
1159415408 18:68141015-68141037 GAGTTAAGTACCTTGTTAACAGG + Intergenic
1159901912 18:74054497-74054519 AAGCTAAGAACCTTGATATAAGG + Intergenic
1160032952 18:75278449-75278471 GAGTTTAGGACCTGGGGAGAAGG - Intronic
1160139421 18:76307776-76307798 GAGTTAAGGATCTTGAGGTAGGG - Intergenic
1163885961 19:19965170-19965192 AAGTTAAGAACCTTGATAAAAGG - Intergenic
1163990010 19:20989415-20989437 AAGTTAAGAACCTTGATAAAAGG + Intergenic
1165395638 19:35562272-35562294 GGGTGAAGGACATTGGGATATGG - Intronic
1167835187 19:52062461-52062483 GAGTTAAGCAGCATGGAATATGG - Intronic
929405658 2:41638097-41638119 AAGTTAAGAACCTTGATAAAAGG + Intergenic
929924308 2:46196294-46196316 GTGTTAATGACCTTCGTAAATGG + Intergenic
930371324 2:50504971-50504993 AAGTTAAGGAACTTGGTTTTGGG - Intronic
932142527 2:69292643-69292665 GAGTTTAGTACCTTGGGATTTGG - Intergenic
933544159 2:83688781-83688803 GAGTTAAGGGGCTTGGGAAAAGG + Intergenic
934039385 2:88115433-88115455 AAGGTAAGGACCTTGAGATAGGG - Intergenic
934948726 2:98561493-98561515 GAGATATGGAACTTGGTAGAAGG - Intronic
935134244 2:100285560-100285582 CAGTTAAGGACTTTGGGATGGGG + Intronic
936712519 2:115148339-115148361 GAGTTAATGACCTTGAGATGAGG + Intronic
936848951 2:116873108-116873130 AAGTTAAGAACCTTGATAAAAGG - Intergenic
937562841 2:123245969-123245991 AAGTTAAGAACCTTGATAAAAGG + Intergenic
937966942 2:127519726-127519748 AAGGTAAGGACCTTGAAATAGGG + Intronic
938224156 2:129601488-129601510 AAGTTAAGAACCTTGATAAAAGG - Intergenic
938643287 2:133305037-133305059 CATTTCAGGACCTTTGTATATGG - Intronic
940093012 2:149943188-149943210 GAGTTAAGGACCTTGAGATTGGG - Intergenic
940781619 2:157939579-157939601 AAGTTAAGGATCTTGGGATGGGG + Intronic
941470308 2:165876891-165876913 GAGTTAATGAACTTGGAGTATGG + Intronic
942856060 2:180549990-180550012 AAGTTAAGGACCTTGAAACAGGG - Intergenic
943112209 2:183620854-183620876 AAGCTAAGAACCTTGGTAAAAGG - Intergenic
945207369 2:207345686-207345708 AAGCTAAGAACCTTGGTAAAAGG + Intergenic
948527736 2:238582580-238582602 AAGTTAAGGATCTTGGGATGGGG - Intergenic
948696015 2:239733330-239733352 GAGTTCAGGGCCCTGGAATAGGG + Intergenic
948696097 2:239733630-239733652 GAGTTCAGGGCCCTGGAATAGGG + Intergenic
1169421196 20:5462290-5462312 AAGCTAAGAACCTTGGTAAAAGG - Intergenic
1170955348 20:20974463-20974485 AAGTTAAGGATCTTGAGATAGGG - Intergenic
1171095036 20:22324771-22324793 GTGTTCAGGACCTTGGGGTAAGG + Intergenic
1174706977 20:52667222-52667244 TAGTTAAGGATCTTGGGATGAGG - Intergenic
1175774249 20:61642971-61642993 GAGTTAAGGATCTTGAGATGAGG - Intronic
1179721226 21:43316956-43316978 AAGTTAAGGATCTTGAGATAAGG + Intergenic
1183276880 22:36904057-36904079 GAGTCAAGGCCCTGGGTATTGGG + Intergenic
1184457415 22:44619023-44619045 GAGTGAAGGAGCATGGTATGTGG + Intergenic
949098398 3:113850-113872 AAGTTAAGGATCTTGAGATAGGG - Intergenic
950897063 3:16462412-16462434 AAGTTAAGGACCTTGGAAAGAGG + Intronic
952336522 3:32407992-32408014 AAGTTAAGGATCTTGAAATAAGG + Intronic
955175795 3:56612083-56612105 GAGTTGAGGACCATGGCAGATGG - Intronic
958520785 3:95183654-95183676 AAGTTAAGAACCTTGATAAAAGG - Intergenic
958635837 3:96744524-96744546 TAGTTAAGGACCTTGAGATGTGG - Intergenic
958736161 3:98011569-98011591 AAGTTAAGGATCTTGAAATAGGG - Intronic
959099789 3:101997299-101997321 AGGTTAAGGACCTTGGAATGAGG + Intergenic
959167077 3:102793827-102793849 GAGTTAAGGACATTGAGATGGGG + Intergenic
959258845 3:104049176-104049198 GAGTTAAGAACCTTGATAAAAGG + Intergenic
960584501 3:119308625-119308647 AGGTTAAGGACCTTGAGATAGGG - Intronic
962007655 3:131363560-131363582 GAGCTGAGGACTTTGGTACAAGG + Intergenic
962010066 3:131383371-131383393 GAGATGAGGACCTTGGTACTAGG + Exonic
962578362 3:136775075-136775097 GAATTAAGGATCTTCATATATGG - Intergenic
964377889 3:156068065-156068087 AAGCTAAGAACCTTGGTAAAGGG - Intronic
964737943 3:159935283-159935305 GAGTTAAGGGACTTCTTATATGG + Intergenic
965227240 3:166005659-166005681 GAGTTATGGTGTTTGGTATATGG + Intergenic
971004931 4:22362586-22362608 CAGTTAAGGACCTTGATATGGGG - Intronic
972936761 4:44145992-44146014 GAGTTTAGGAACTTGCTCTAGGG - Intergenic
973990940 4:56406410-56406432 AAGTTAAGGATCTTTGTAAAGGG - Intronic
974594751 4:64000730-64000752 GAGTTAAAGGCCCTGGTATCTGG - Intergenic
975197298 4:71540839-71540861 GAGGGAAGGAGCTTGGTATATGG + Intronic
975620195 4:76289533-76289555 AAGTTAAGAACCTTGACATAAGG - Intronic
975733171 4:77357160-77357182 GAGTTAAAGACCTTCATATGAGG - Intronic
975978842 4:80132043-80132065 AAGTTAAGGATCTTGAGATAAGG + Intergenic
978107151 4:104916855-104916877 AAGTTAAGGACCTTGATATGAGG + Intergenic
979208053 4:118065045-118065067 AAGTTAAGGACTTTGATATGGGG - Intronic
979583747 4:122390757-122390779 AAGCTAAGAACCTTGGTAAAAGG - Intronic
980832345 4:138147077-138147099 GTCTTAAGGACCTAGGTATATGG + Intergenic
983788188 4:171760280-171760302 GAGGTAAGAACCTTGGAAAAAGG + Intergenic
986996650 5:13614532-13614554 AAGTTAAGAACCTTGATAAAAGG + Intergenic
990897452 5:60714818-60714840 GAGCTAAGAACCTTGATAAAAGG - Intergenic
992287419 5:75249362-75249384 AAGCTAAGGACCTTGATAAAAGG + Intergenic
994344659 5:98669848-98669870 AAGTTAAGAACCTTGATAAAAGG + Intergenic
995080808 5:108048544-108048566 GAGCTAAGAACCTTGATAGAAGG + Intronic
995263659 5:110134933-110134955 AAGCTAAGGACCTTGATAAAAGG - Intergenic
996330378 5:122321658-122321680 GAGTTGAAGGGCTTGGTATATGG + Intronic
996387925 5:122928394-122928416 AAGTTAAGGACCTTGAGATAAGG + Intronic
997120440 5:131167690-131167712 AAGTTAAGGATCTTGGAATAGGG + Intronic
997689040 5:135813193-135813215 GAGTTATGAACCTTGGGAGATGG - Intergenic
998133748 5:139664074-139664096 GAGTTAAGGAGCTGGGCATGGGG - Intronic
999780641 5:154847374-154847396 GAGTAAAGGACATGGGAATAAGG + Intronic
1001698125 5:173687777-173687799 AGGCTAAGGACCTTGGAATAGGG - Intergenic
1001849462 5:174951061-174951083 GACTTAAGGATTTTTGTATATGG - Intergenic
1002539206 5:179894700-179894722 GACTCATGGACCTTGGTCTAAGG + Intronic
1003878356 6:10458136-10458158 AAGTTAAGGATCTTGGGATGAGG - Intergenic
1004330405 6:14715705-14715727 GAGTTGGGGACTTTCGTATAGGG - Intergenic
1004421419 6:15473559-15473581 CTCTTAAGGACCTTGGTATATGG - Intronic
1005204960 6:23392268-23392290 AAGTTAAGGATCTTGGGATGGGG + Intergenic
1007583815 6:42976304-42976326 TAATTAAGGACCTAGATATATGG - Intronic
1009041451 6:58184002-58184024 AAGTTAAGGATCTTGAGATAAGG - Intergenic
1009201800 6:60755249-60755271 AAGTTAAGGACTTTGAGATAGGG - Intergenic
1009217302 6:60938317-60938339 AAGTTAAGGATCTTGAGATAAGG - Intergenic
1009336202 6:62493258-62493280 AAGTTAAGAACCTTGATAAAAGG + Intergenic
1009372349 6:62921756-62921778 GAATTAAGGACCTTGAGGTAGGG - Intergenic
1010059684 6:71608171-71608193 AAGTTAAGGATCTTGAGATAAGG - Intergenic
1013770912 6:113626999-113627021 AAGTTAAGGACCTTGAGATGGGG - Intergenic
1014283378 6:119466409-119466431 AAGTTAAGGATCTTGAGATAAGG + Intergenic
1014635261 6:123838235-123838257 GACTTAAGGACTTTGGCTTATGG - Intronic
1017583224 6:155890221-155890243 ATGTTAAGGACATTGGTAGAAGG - Intergenic
1020557860 7:9692190-9692212 AAGTTAAGAACCTTGATAAAAGG + Intergenic
1021883061 7:25112437-25112459 AAGTTAAGGATCTTGAGATAGGG - Intergenic
1021897720 7:25252934-25252956 GAGTTAAGGATATTGATATGGGG + Intergenic
1028583919 7:92434535-92434557 AAGTTAAGGACTTTGGGATGGGG + Intergenic
1031397602 7:121292419-121292441 AAGTTAAGAACCTTGATAAAAGG - Intronic
1033112720 7:138596344-138596366 GAGCAAATGAACTTGGTATATGG - Intronic
1033409878 7:141107645-141107667 GAGATAAGGGCTTTGGTTTAGGG + Intronic
1033808281 7:144979125-144979147 TCGTTAAGGAGCTAGGTATAAGG - Intergenic
1034365630 7:150543875-150543897 AAGCTAAGGACCTTGATAAAAGG + Intergenic
1038259710 8:25982202-25982224 GAGTTCAGAACATTGGTGTATGG - Intronic
1038387369 8:27161446-27161468 AAGTTAAGGATCTTGACATAGGG + Intergenic
1038424416 8:27455166-27455188 AAGTTAAGGACCTTGAGATTGGG + Intronic
1038843909 8:31211373-31211395 GATTGAAGGACGTTGGTATGGGG - Intergenic
1039754705 8:40511333-40511355 AAGCTAAGGACCTTGATAAAAGG - Intergenic
1041155198 8:54978124-54978146 AAGCTAAGGACCTTGATAAAAGG + Intergenic
1043036536 8:75207229-75207251 AAGTTAAGAACCTTGATAAAAGG - Intergenic
1043207068 8:77458144-77458166 AAGTGAATGACCTTGGCATAAGG - Intergenic
1043345299 8:79291193-79291215 AAGTTAAGGACCTTGAAATGAGG + Intergenic
1044355292 8:91215117-91215139 AAATTAAGGACCTTGAGATAAGG - Intronic
1044828350 8:96220286-96220308 CAGTTAAGGACCTTGAGATGGGG + Intergenic
1046138213 8:110059135-110059157 GAATTAAAGACCTTGAGATAAGG - Intergenic
1050031907 9:1394619-1394641 GAGCTAAGAACCTTGATAAAAGG + Intergenic
1051932311 9:22400808-22400830 AGGTTAAGGACCTTGGGATAGGG - Intergenic
1051983049 9:23046931-23046953 AAGCTAAGGACCTTGATAAAAGG + Intergenic
1052764538 9:32627322-32627344 GAGTTAAGGATCTTGAGATGAGG - Intergenic
1054814690 9:69463843-69463865 GGGTTAAGGACATTGCTAAATGG + Intronic
1055823753 9:80300179-80300201 AAGCTAAGGACCTTGATAAAAGG - Intergenic
1056129947 9:83574611-83574633 TATTTAAGGACCTTGGTTTGGGG + Intergenic
1059162744 9:112050698-112050720 GAGTTTATGACCTTGGAATCTGG - Intronic
1186138836 X:6549349-6549371 GAGTTAAGGACTTTGAGATGAGG + Intergenic
1186274301 X:7923194-7923216 CAGTTAAGGACCTTGAGATGAGG + Intronic
1186497405 X:10022641-10022663 AAGTTAAGGATCTTGAGATAAGG + Intronic
1186621930 X:11250771-11250793 GAGTTAAGGTCCTTGAGATAGGG - Intronic
1186656508 X:11617548-11617570 AAGTTAAGGACCTTGAAATGAGG + Intronic
1186765481 X:12766372-12766394 AAGTTAAGGACTTTGAGATAGGG - Intergenic
1189246714 X:39568932-39568954 GAGTTAAGGATCTTGATATGTGG - Intergenic
1192933830 X:75838169-75838191 AAGCTAAGAACCTTGATATAAGG - Intergenic
1194515200 X:94844091-94844113 AAGCTAAGGACCTTGATAAAAGG - Intergenic
1194596847 X:95868865-95868887 AAGTTAAGAACCTTGATAAAAGG + Intergenic
1194782996 X:98048257-98048279 AAGTGAAGAACCTTGATATAAGG - Intergenic
1196302893 X:114066805-114066827 AAGTTAAGGACTTTGAAATAGGG + Intergenic
1197290561 X:124651971-124651993 GGATCAAGGACCTTGGTATCTGG - Exonic
1198687765 X:139245776-139245798 CAGTTAAGGTCCTTGTTAAAAGG + Intergenic
1199675698 X:150187455-150187477 GACTTAAGGATCTTGGGATGGGG - Intergenic
1199897267 X:152137304-152137326 GAGGTGAGGACCTTGGTCTGAGG - Intronic
1201462400 Y:14240535-14240557 AAGTTAAGAACCTTGATAAAAGG + Intergenic