ID: 1079922026

View in Genome Browser
Species Human (GRCh38)
Location 11:26444711-26444733
Sequence GTATCTTGGTTTTTCTCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 225}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079922019_1079922026 28 Left 1079922019 11:26444660-26444682 CCCAGTAAACATTTAATATGGCC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1079922026 11:26444711-26444733 GTATCTTGGTTTTTCTCTACAGG 0: 1
1: 0
2: 2
3: 21
4: 225
1079922020_1079922026 27 Left 1079922020 11:26444661-26444683 CCAGTAAACATTTAATATGGCCA 0: 1
1: 0
2: 0
3: 12
4: 153
Right 1079922026 11:26444711-26444733 GTATCTTGGTTTTTCTCTACAGG 0: 1
1: 0
2: 2
3: 21
4: 225
1079922023_1079922026 7 Left 1079922023 11:26444681-26444703 CCAGGATAAAGAATTTCTGGCCT 0: 1
1: 0
2: 1
3: 16
4: 204
Right 1079922026 11:26444711-26444733 GTATCTTGGTTTTTCTCTACAGG 0: 1
1: 0
2: 2
3: 21
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079922026 Original CRISPR GTATCTTGGTTTTTCTCTAC AGG Intronic
902189205 1:14749635-14749657 GTAGGTTGGTTTTTCTGCACAGG + Intronic
908199038 1:61774988-61775010 GTGTTTTAGTTTCTCTCTACTGG + Intronic
908379602 1:63583662-63583684 ATATCATGGTTTCTCTCTATTGG - Intronic
910781738 1:90944033-90944055 CTATATTAGTTTTTCTCAACAGG + Intronic
913942904 1:125124602-125124624 GTGTCTTGGAGTTTCTCTTCTGG - Intergenic
915944989 1:160143034-160143056 CTATCTAGGTCTCTCTCTACAGG - Exonic
918574367 1:186038642-186038664 GGATCTTGGTGTTTTTCTAAGGG + Intronic
922009992 1:221573791-221573813 CTATCTTATTTGTTCTCTACTGG + Intergenic
924531747 1:244899639-244899661 CTATTCTGGTTTTTCTCTCCTGG - Intergenic
924716853 1:246583277-246583299 GTATCTTTGATTTTCTGTAATGG + Intronic
1064113964 10:12561924-12561946 GCATGTTGGTTTATCTCTCCAGG + Intronic
1064445914 10:15392627-15392649 GGACCTTGGTTTTTCACTGCAGG - Intergenic
1066785689 10:39001679-39001701 GTAATTTGGTTTTTCTCCATAGG + Intergenic
1066792937 10:39086060-39086082 GTATATTGGTTTTTCCCTTAGGG - Intergenic
1067236136 10:44451892-44451914 GTATCTGGGTTTTCCTGTATTGG + Intergenic
1067257614 10:44659645-44659667 GCATTTTGGTTTTTCTGTCCTGG + Intergenic
1068262103 10:54595737-54595759 GTTTGTTTGTTTTTCTGTACTGG - Intronic
1069414533 10:68186277-68186299 GTTTCTTGGTTTTAATTTACTGG - Intronic
1075299434 10:121308423-121308445 GTGTGTTGGTTTTCCTCTTCAGG + Intergenic
1076295359 10:129379755-129379777 GTCTGTTAATTTTTCTCTACGGG + Intergenic
1078783007 11:14457883-14457905 ATATCTTAATTTTTCTTTACAGG - Exonic
1079311570 11:19371242-19371264 TTATCTTGATTTTTTTCCACGGG + Intronic
1079537758 11:21535424-21535446 GTATATTGTTTTTTTTCTAAAGG + Intronic
1079922026 11:26444711-26444733 GTATCTTGGTTTTTCTCTACAGG + Intronic
1081364093 11:42213856-42213878 GTATCTTGTTTTTGTTTTACAGG + Intergenic
1082587398 11:54958602-54958624 GAATTTTCTTTTTTCTCTACTGG - Intergenic
1083122451 11:60528157-60528179 GTATTTTAGCTTTACTCTACTGG + Intronic
1083593084 11:63906605-63906627 GTATCTTGTTTGTTGTCTCCTGG + Intronic
1084850172 11:71932837-71932859 GAATATTGGTTTTTCCATACAGG + Intronic
1085678600 11:78549226-78549248 GTTTCTTGGCTTGTCTCTCCTGG - Intronic
1086037520 11:82434802-82434824 GTCACCTGGTTTTTCTCTAGGGG - Intergenic
1089921785 11:122215762-122215784 CTACCTTGGCTTTTCTTTACCGG - Intergenic
1091264711 11:134261598-134261620 GTCTCTTGCTTTTTCTATAGAGG - Intronic
1092528550 12:9325897-9325919 GCATGTTGGTTTTTCTCCAGGGG + Intergenic
1093435807 12:19132714-19132736 GTATCTTCGTTTTTTTCTTTTGG + Intronic
1095047570 12:37525037-37525059 GGATATTGGTTTTTCACTACAGG + Intergenic
1098443284 12:70540239-70540261 GTCTCCTGGTTTTTGGCTACAGG + Intronic
1098696600 12:73565460-73565482 TTAGTTTTGTTTTTCTCTACTGG - Intergenic
1100397504 12:94197776-94197798 GTCTCTTTGTTTTGCTCTAATGG - Intronic
1102935177 12:116890488-116890510 GTATGTTGGTTTTAGTCTTCAGG + Intergenic
1103485201 12:121278272-121278294 GTATCTTGAGTTTCCTCTTCTGG - Intronic
1104088003 12:125493503-125493525 GCATGTTAGTTTTTCTCCACTGG + Intronic
1104875824 12:132033955-132033977 GGATCCTTGTTTTTCTTTACAGG - Intronic
1105679697 13:22713755-22713777 GTAACTTGATTTTTATCTCCTGG + Intergenic
1105823315 13:24099200-24099222 TTATCCTGCTTTATCTCTACAGG + Intronic
1108003982 13:45929513-45929535 TTAGCTTGGTGTTTCTCTAAGGG - Intergenic
1109973481 13:69800826-69800848 AAATATTGGTTTTTCTCTAAGGG - Intronic
1111593898 13:90387188-90387210 ATCTTTTGGTCTTTCTCTACTGG - Intergenic
1111733698 13:92109997-92110019 GTATCTTTTATTTTTTCTACTGG - Intronic
1113212206 13:107996458-107996480 GGTTCTTGGATTTTCTTTACTGG + Intergenic
1113898156 13:113778845-113778867 ATTTCTGGGTGTTTCTCTACGGG - Intronic
1114403219 14:22429431-22429453 GGTTCTTGGTTTTTCTTTTCTGG + Intergenic
1116681219 14:47972680-47972702 GTATCTTGGGTTTGATCTTCTGG + Intergenic
1116711194 14:48370728-48370750 GTGTCTTGGAGTTTCTCTTCTGG + Intergenic
1116719813 14:48482005-48482027 GTGTCTTGGAGTTTCTCTTCTGG - Intergenic
1120353489 14:83395567-83395589 GTTTCTGGGTGTTTCTCTAAGGG - Intergenic
1121335740 14:93076619-93076641 TTTTCTTTGTTTTTCTCCACAGG - Exonic
1122521200 14:102345010-102345032 TTTTCTTTCTTTTTCTCTACAGG - Intronic
1202943229 14_KI270726v1_random:2924-2946 GTGGCTTTGTTTCTCTCTACAGG + Intergenic
1125798152 15:42419586-42419608 CTGTCTTGGCTTTTCCCTACAGG + Intronic
1126238871 15:46417951-46417973 GTTTCTAGCTTTTTCTCTCCTGG + Intergenic
1129519093 15:76174770-76174792 GTGACGTGGTTTTTCTCTGCTGG + Intronic
1131089331 15:89609447-89609469 GTTTATTGTTTTTTCTCTATTGG + Intronic
1135085565 16:19472166-19472188 GTAGCCTGGGTTGTCTCTACAGG + Exonic
1137045859 16:35660256-35660278 GAAATTTGGTTTTTCACTACGGG - Intergenic
1137058637 16:35762344-35762366 GTTTTTTGGTTTTTCACTATTGG + Intergenic
1138330296 16:56209179-56209201 GTAAGTTGTTTTTTCTCTAATGG + Intronic
1140312146 16:73859935-73859957 GTCTCTTGGTGTTTGTCTACAGG - Intergenic
1140424271 16:74847893-74847915 GTATCGTGATTTTTATCTCCTGG - Intergenic
1144149165 17:12426930-12426952 GAATCCTGGATTTTCACTACAGG - Intergenic
1145100370 17:20071412-20071434 GTAACTTGATTCTTCTCTAAAGG - Intronic
1145255536 17:21320167-21320189 TTATCTGGGTTGTTCTCCACAGG + Intergenic
1145364911 17:22252513-22252535 GCATATTGGTTTTTCACTATAGG + Intergenic
1145365056 17:22254913-22254935 GGATATTGGTTTTTCTCTACAGG + Intergenic
1145410855 17:22661586-22661608 GGATATTGGTTTTTCACTACAGG + Intergenic
1145412519 17:22682379-22682401 GGATATTGGTTTTTCACTATAGG + Intergenic
1145730709 17:27182571-27182593 GACTTTTGGTTTTTCACTACAGG - Intergenic
1145868868 17:28257523-28257545 TTTCCTTGGTTTTTCTCTTCTGG + Intergenic
1146047591 17:29522750-29522772 GAATCTTGATTCTTATCTACTGG - Intronic
1146168036 17:30607032-30607054 CTATCTTGGTATATATCTACTGG - Intergenic
1146648388 17:34590673-34590695 GTATCTTGCTATTTCTTCACAGG - Intronic
1149830024 17:59863845-59863867 TTATCTTGTTTTTACTCTAGAGG - Exonic
1151500301 17:74483979-74484001 GTTTCTTGGTTTCTCTCTGCAGG + Exonic
1154053339 18:10984704-10984726 GTATGTTTGTTTCACTCTACAGG - Intronic
1154171915 18:12058634-12058656 GTTCCTGGGTTTTTCTTTACTGG - Intergenic
1157268034 18:46246078-46246100 GTATTTACATTTTTCTCTACAGG + Intronic
1159368621 18:67502835-67502857 TTATATTGGTTTTTCTCTTTGGG + Intergenic
1159396934 18:67871507-67871529 TTATCTTGGTTTATCTCTAGTGG - Intergenic
1159808657 18:72988676-72988698 GCATCTTTATTTTTCTCAACAGG - Intergenic
1160117255 18:76091366-76091388 CTCTCTTGTTTTTCCTCTACTGG - Intergenic
1161064416 19:2230599-2230621 GTCCCTTGGTGTTTCTGTACAGG + Exonic
1164064240 19:21700892-21700914 ATTTCTTGATTTTTCACTACAGG + Intergenic
925591388 2:5513157-5513179 CTACTTTGGTTTTTCTCTATTGG + Intergenic
927276883 2:21269518-21269540 GTATCATTGTTTTGCTTTACAGG - Intergenic
929143263 2:38684974-38684996 GTATTTTGGCTTTTGTCTTCAGG + Intronic
929846610 2:45536428-45536450 TTATTTGTGTTTTTCTCTACTGG + Intronic
931346640 2:61452861-61452883 GTGTCTTGGTCTGTCTCTAAGGG - Intronic
931947729 2:67329746-67329768 GTCTTTTGGTTTTCCTCTGCAGG - Intergenic
933224884 2:79736842-79736864 TTATCTTGGTTCTCCTTTACTGG + Intronic
936591094 2:113805270-113805292 TTTCCTTGGATTTTCTCTACTGG - Intergenic
938136919 2:128766373-128766395 TTATTATGGTTTTTCTCTATGGG + Intergenic
938185373 2:129227186-129227208 TTATCTTGCTTTTTCTCTTATGG + Intergenic
938978279 2:136500693-136500715 GTATCCTGGGATTTCTCTATTGG - Intergenic
940884833 2:158980166-158980188 GTATTTTTGTTTTTAACTACAGG + Intronic
941112561 2:161431548-161431570 GTTTCTTTGTCTTTCTCCACAGG - Intronic
942175215 2:173326848-173326870 TTCTCTTGGTTTTTCTCTTAAGG + Intergenic
942723406 2:178980182-178980204 GTATTTTGATGTTTCTCTACAGG - Intronic
943908120 2:193526955-193526977 CTACCTTTGTTCTTCTCTACAGG - Intergenic
945524830 2:210875106-210875128 ATAGCTTGGTTTTTATCTACCGG + Intergenic
946266055 2:218542578-218542600 TCACCTTGGTTTTTCTATACAGG + Intronic
946496005 2:220196263-220196285 GTATCTTGGATTTTCTTTATTGG + Intergenic
948065224 2:235073528-235073550 GTATTTTGGATTTTCTCTGTTGG - Intergenic
1169597754 20:7220283-7220305 CTAGTTTGGTTTTTCTATACTGG + Intergenic
1170009263 20:11703689-11703711 GAATATGGGTTTTTCTCTCCTGG - Intergenic
1170333107 20:15237150-15237172 GTATCTTGGTGTTTATAAACAGG - Intronic
1171542105 20:25968517-25968539 GAATATTGGTTTTTCACTACAGG + Intergenic
1171798908 20:29591390-29591412 CGATATTGGTTTTTCACTACAGG - Intergenic
1171845154 20:30265170-30265192 GGATATTGGTTTTTCACTACAGG + Intergenic
1174848386 20:53966868-53966890 GTATCTTAGGTTTCCTATACTGG + Intronic
1178737901 21:35169248-35169270 GTATTTTGAGGTTTCTCTACTGG - Intronic
1179559548 21:42205659-42205681 GTTTCATTGATTTTCTCTACTGG + Intronic
1180847667 22:18993059-18993081 GGAGCTTGCTTTTTCTCTGCTGG + Intergenic
1182693577 22:32180639-32180661 GTTTCCTGGTCATTCTCTACCGG + Intergenic
950022676 3:9799266-9799288 GTATATTGGTTTGCCTGTACAGG + Intronic
951016809 3:17741366-17741388 ATATATTGGTTTTTCTCTTTGGG - Intronic
951271242 3:20626896-20626918 GTTTCTGGGCTTTTCTTTACTGG + Intergenic
951973107 3:28471121-28471143 GGTTCTTGGTTTTTCTTTGCTGG - Intronic
952513114 3:34076759-34076781 GAATTTTGGCTTTTCTCTGCAGG + Intergenic
954856788 3:53650757-53650779 GTTTCTTTGTTTTTCTTCACAGG + Exonic
956922228 3:73941955-73941977 TTATCTTGGTTTTTCCTTTCAGG + Intergenic
957623946 3:82633618-82633640 TTATTTTGGTATTTCTCTCCTGG + Intergenic
959021013 3:101187478-101187500 GTATCTTTGTTTTGCTATAAGGG + Intergenic
959347212 3:105212621-105212643 TTTTATTGATTTTTCTCTACTGG + Intergenic
960136020 3:114106153-114106175 GAATCTTGATTTTTCTTTTCAGG + Intergenic
961577551 3:127850200-127850222 GTCTGTTGGACTTTCTCTACAGG - Intergenic
963664245 3:148162290-148162312 GAATCGTTGTTTTACTCTACAGG + Intergenic
965548711 3:169941790-169941812 GTATCTTTCTTTTAATCTACAGG - Intergenic
973349189 4:49091045-49091067 GGATATTGGTTTTTCACTGCAGG - Intergenic
973529532 4:51821215-51821237 GGATATTGGTTTTTCACTGCAGG - Intergenic
974547284 4:63328805-63328827 GGATATTGGTTTTTTACTACAGG + Intergenic
974547311 4:63329147-63329169 GGATATTGGTTTTTTACTACAGG + Intergenic
974548304 4:63340681-63340703 GGATATTGGTTTTTCACTATAGG + Intergenic
974548412 4:63342205-63342227 GTATATTGGTTTTTCACTACAGG + Intergenic
974548441 4:63342718-63342740 GTATTTTGGTTATTCACTATAGG + Intergenic
974806909 4:66892472-66892494 GTATTATGGTTTTTCTCTCTTGG + Intergenic
975609139 4:76186544-76186566 GTATCCTGCTTTGTATCTACAGG - Intronic
976559881 4:86489044-86489066 GTATCTTGGTTCTCCTCCAGTGG - Intronic
976913922 4:90345910-90345932 GTATTTTATTTTTTCTCTATAGG + Intronic
977467577 4:97401821-97401843 GTATCTTGGGGTTGCTCTTCTGG + Intronic
981647706 4:147018884-147018906 GTATCTTTGTTTTTCTCCATGGG + Intergenic
984494202 4:180474052-180474074 TTATCTTGGATTTTCTGGACAGG - Intergenic
984597040 4:181681760-181681782 TTATCTTGTTTTATCCCTACTGG - Intergenic
984942151 4:184942488-184942510 CTATCTTGGATTTGCTCTTCAGG - Intergenic
986651538 5:9968466-9968488 GTTTCTGGGCTTTTCTTTACTGG - Intergenic
987458543 5:18177332-18177354 GTATAGTTGCTTTTCTCTACAGG + Intergenic
988015117 5:25546420-25546442 GTATGTTGATTATTCTTTACTGG + Intergenic
988353765 5:30145452-30145474 GTTCCTGGGCTTTTCTCTACTGG + Intergenic
988480356 5:31625108-31625130 AAGTTTTGGTTTTTCTCTACTGG - Intergenic
988514134 5:31890465-31890487 GTTTCTTCATTTTTCCCTACCGG - Intronic
990611519 5:57461670-57461692 GTATTTTGGATTCTCTCTGCAGG - Intergenic
990873102 5:60455178-60455200 GTATTTTGCTTTTTCTTTTCTGG - Intronic
991616593 5:68503103-68503125 GTGTCTTTGTTTGTCTCTGCAGG - Intergenic
992726291 5:79611360-79611382 CTTTCTTGGATTTTCTCTACTGG - Intergenic
994323082 5:98415558-98415580 GTATTTTGATTTTTCCTTACTGG - Intergenic
995710510 5:115030676-115030698 TAACCTTGGTTTTTCTCTGCAGG - Intergenic
996800926 5:127401863-127401885 CTCTCTTGGTTTTTCTCCCCAGG + Intronic
996953132 5:129151947-129151969 GTATCTTGGAGTTACTCTTCTGG + Intergenic
998847752 5:146327317-146327339 GATTCTTGGGTTTTCTCTTCAGG - Intronic
1002377366 5:178797826-178797848 GTGTCAGGGTTTTTCTCTCCAGG - Intergenic
1003903617 6:10678523-10678545 GTCTGTAGGGTTTTCTCTACAGG + Intronic
1005075617 6:21903608-21903630 GTATGTTGGTTTTACTTGACTGG + Intergenic
1005817769 6:29570253-29570275 ATTTCTTGTTTCTTCTCTACTGG - Intronic
1008210897 6:48724564-48724586 GTTACTTGATTTTTCTCTAGTGG + Intergenic
1008662232 6:53679981-53680003 GAATTTTTGGTTTTCTCTACTGG + Intergenic
1008715552 6:54284888-54284910 AAATCTTGTTTTTCCTCTACTGG + Intergenic
1011731834 6:90272952-90272974 CTGTCTTGTTTTCTCTCTACTGG - Intronic
1012225569 6:96699783-96699805 GTCTCTTGGTTCTACTGTACTGG + Intergenic
1012238573 6:96846649-96846671 GGATCTTCTTTTTTCTTTACTGG - Intergenic
1012926913 6:105276717-105276739 ATGGCTTGGTTTTTCTCTACTGG - Intergenic
1013076452 6:106776032-106776054 GTCTCTTAGTTTTTCTGAACTGG - Intergenic
1013653976 6:112226098-112226120 GGATCTTGGTGTTTCTCTCTCGG + Intronic
1014355365 6:120402137-120402159 CTATCAGGGTTTTTCTTTACTGG + Intergenic
1015655537 6:135514268-135514290 TAATCTTGGTTTATCTTTACTGG + Intergenic
1017571579 6:155750199-155750221 GTATCTTGGGGTTGCTCTTCTGG - Intergenic
1018321428 6:162613526-162613548 CTGTCTTGGTTATACTCTACAGG - Intronic
1024198276 7:47081435-47081457 GTATCGTGCTATTTCTCTAGAGG - Intergenic
1025222132 7:57120878-57120900 ATATCTTGTTTTATCTCTATTGG + Exonic
1025293565 7:57754842-57754864 GGATATTGGTTTTTCACTACAGG + Intergenic
1025632915 7:63292550-63292572 ATATCTTGTTTTATCTCTATTGG + Intergenic
1025649782 7:63455633-63455655 ATATCTTGTTTTATCTCTATTGG - Intergenic
1027974962 7:85141450-85141472 GTGTCTTGATCTTTCTCCACTGG + Intronic
1029850856 7:103460420-103460442 GAATCTTGGTGCTTCTCTATTGG + Intergenic
1029877069 7:103765310-103765332 GTGTCTTGGTCCTTCTCTTCTGG + Intronic
1030424077 7:109350093-109350115 TAATCTTAGTTTTTCCCTACAGG - Intergenic
1031615991 7:123880213-123880235 GTATCTTGCTGTTTCTGTAAAGG - Intergenic
1031995840 7:128230311-128230333 GTATTTTGCTTTTTCTGTAAAGG + Intergenic
1033022470 7:137740224-137740246 GTATCTTGGTTTATCAATTCTGG + Intronic
1033515101 7:142097528-142097550 GTATTTTGGTTTCTCTGTCCTGG + Intronic
1033523200 7:142182854-142182876 GTATTTTGGTTTTTCTCCATGGG + Intronic
1033592684 7:142825991-142826013 TTACTTTGGTTTTTCTTTACTGG - Intergenic
1034331576 7:150287697-150287719 GTATCTTGGATATACTCTAGCGG + Intronic
1034666463 7:152822170-152822192 GTATCTTGGATATACTCTAGCGG - Intronic
1036061172 8:5322877-5322899 TTATCATGCTTTTTCTCTACTGG + Intergenic
1037210497 8:16380193-16380215 GTATCTTTGTCTCTCTCTTCTGG - Intronic
1040281793 8:46056887-46056909 GAAATTTGGTTTTTCACTACAGG - Intergenic
1040283661 8:46088460-46088482 GGATTTTGGTTTTTCACTATAGG - Intergenic
1040344518 8:46476611-46476633 GTTATTTGGTTTTTCTCTATAGG + Intergenic
1042819350 8:72913458-72913480 GTACCTTGGTATTTCTATAAGGG - Intronic
1043006794 8:74829895-74829917 GTGTCATGGTTTTTCTCTGCTGG - Intronic
1044578585 8:93798795-93798817 GTATTTTGGTTTTTCTTAAATGG + Intronic
1045809396 8:106203579-106203601 GTATATTGTCTTTTCTCAACAGG + Intergenic
1046207437 8:111019326-111019348 TTACCTTAGTTTTTCTTTACTGG - Intergenic
1047517643 8:125569050-125569072 GGTCTTTGGTTTTTCTCTACAGG + Intergenic
1047652996 8:126944967-126944989 GTATCTTATTTGATCTCTACTGG + Intergenic
1048411419 8:134178045-134178067 GTATCTCGTTAATTCTCTACAGG - Intergenic
1048522208 8:135167139-135167161 GTATCTTGGTCTTCCTTTTCTGG + Intergenic
1048846620 8:138608653-138608675 CTTTCTTGTTTTTACTCTACTGG - Intronic
1049877943 8:145039014-145039036 GTTTCATGGATTTTCTCTGCTGG + Intergenic
1051503383 9:17802208-17802230 CTCTCTTGGTTTTTCTTTTCTGG + Intergenic
1051731790 9:20151460-20151482 GTATCTTGGCTTTTCTTTTATGG + Intergenic
1051934050 9:22422752-22422774 GAATTTAGGTTTTTCTCTACTGG + Intergenic
1052144372 9:25029434-25029456 GTTTCTGGGTTTTTCTGTACTGG - Intergenic
1052334965 9:27309699-27309721 GTATCTTAGGTTTACTCTAAAGG - Intergenic
1052804672 9:33002122-33002144 GCATCTTGCTTTTTTTCTCCCGG - Intronic
1053848197 9:42263251-42263273 GTCTCTAGGTTTTTCTAGACAGG - Intergenic
1054162925 9:61690672-61690694 GGATATTGGTTTTTCACTACAGG - Intergenic
1054735949 9:68749878-68749900 CTACCTTGGTGTTTCTCAACAGG - Intronic
1056240650 9:84643133-84643155 GTAGCTTGGGTTTTCACTTCAGG + Intergenic
1058216852 9:102244982-102245004 GTATCTTGGTTTCTCTCGTAAGG + Intergenic
1058574258 9:106383095-106383117 TTATCCTGGTTTATCTCTTCTGG + Intergenic
1060555109 9:124504122-124504144 CTCTCTTGGGTTTTCTCTTCGGG - Intronic
1061381798 9:130263211-130263233 GTATCTTGCTTTTTTTCTTTGGG + Intergenic
1061787914 9:133041899-133041921 GTATCTTAGTTTTTATCTGGTGG - Intronic
1062215875 9:135389540-135389562 GTGGCTTGGTTTGTCTCTCCTGG - Intergenic
1186150352 X:6668129-6668151 GTATCTTTATTTTTCCCCACAGG - Intergenic
1186588416 X:10901789-10901811 GTATCTTTGTTTCTCTCATCTGG - Intergenic
1187902139 X:24035116-24035138 GTCTCTGGGTTTTTCTTCACTGG + Intergenic
1188142137 X:26564593-26564615 TTATCTTGGATTATCTCTATGGG + Intergenic
1191585140 X:62817364-62817386 GTTTTTTGGTTTTTCACTATAGG + Intergenic
1192606735 X:72526462-72526484 GTATCTTGGTTTTCCTTTTAGGG + Intronic
1193526848 X:82601278-82601300 GTCTTTAGGCTTTTCTCTACTGG + Intergenic
1193967067 X:88001241-88001263 GTATATTGGTTTTTTTCTCTAGG + Intergenic
1194834647 X:98667112-98667134 GGTTCTGGGCTTTTCTCTACTGG + Intergenic
1196652623 X:118183773-118183795 GTATCTTGGTTTTGTTCTTATGG - Intergenic
1200425472 Y:3015834-3015856 GTTTCTTAGGTTTTCTCTATGGG - Intergenic
1201491046 Y:14541473-14541495 GTATCTTGGTGTTGCTCTTCTGG - Intronic
1201744395 Y:17354723-17354745 TTATCTTGTTCTTTCTCTTCTGG + Intergenic
1201775479 Y:17659932-17659954 GATACTTGGTTTTTCACTACAGG + Intergenic
1201826077 Y:18246057-18246079 GATACTTGGTTTTTCACTACAGG - Intergenic