ID: 1079927155

View in Genome Browser
Species Human (GRCh38)
Location 11:26508756-26508778
Sequence CTCTGATACTAGGATTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 180}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079927155 Original CRISPR CTCTGATACTAGGATTATGG AGG (reversed) Intronic
900202316 1:1414987-1415009 CTCTGATACTGGGAGCAAGGTGG + Intergenic
901607032 1:10467202-10467224 CTCTGATAGGAGGATGATGCTGG + Exonic
902986576 1:20158092-20158114 CTCTGACACTGGGAGTAAGGTGG - Intergenic
907218380 1:52885584-52885606 TTCTGTTAATGGGATTATGGAGG + Intronic
910852787 1:91665207-91665229 CTCTGATACCAGGAGCAAGGTGG + Intergenic
911903033 1:103529192-103529214 CTCTGAGAGTAGGATTACAGAGG + Intronic
915947821 1:160166987-160167009 CTCTGATACCTGGTTTATGCTGG + Exonic
916663661 1:166946546-166946568 ATCTGATTCTAGGATTCTGTGGG - Intronic
916688298 1:167167638-167167660 CTCTGATCCTAGAATGCTGGGGG - Intergenic
916766635 1:167867109-167867131 CTCTGATACCAGGAGCAAGGTGG - Intronic
918647240 1:186918711-186918733 CTCTGATACTGGGAGCAGGGTGG + Intronic
921927321 1:220722181-220722203 CTCTGATACCAGGAGCAAGGTGG - Intergenic
922693989 1:227717904-227717926 CTCTGATACTGGGAGCAAGGTGG - Intergenic
1064018923 10:11793952-11793974 GTCTGATACCAGGATCAGGGAGG + Intergenic
1065802247 10:29363208-29363230 CTCTGATACCAGGAGTAAGGTGG + Intergenic
1065829671 10:29603232-29603254 CTGTGATACGAGGATGAGGGGGG - Intronic
1065931198 10:30480454-30480476 CTCTGATACCAGGAGCAAGGTGG - Intergenic
1067702304 10:48582779-48582801 CTGTGATACCAGGAACATGGGGG + Intronic
1072229746 10:93404276-93404298 ATCTGATACTATAATTTTGGGGG + Intronic
1072689017 10:97558235-97558257 CTCTGATACCAGGAGTAAGGTGG + Intronic
1072752872 10:97995901-97995923 CTGTAATCCTAGGATTTTGGGGG + Intronic
1072780750 10:98249743-98249765 GCCTGATTCTAGCATTATGGAGG + Intronic
1073177577 10:101565748-101565770 CTCAGATACAAGGATGTTGGTGG - Intergenic
1074301339 10:112235654-112235676 CTCAGATCCTACGATTATGTGGG - Intergenic
1079927155 11:26508756-26508778 CTCTGATACTAGGATTATGGAGG - Intronic
1080250432 11:30227517-30227539 CTGTGAGATTAGGATTATGGGGG - Intergenic
1080789214 11:35506313-35506335 CTCTAATACTAAAATTGTGGTGG - Intronic
1084227765 11:67728007-67728029 CTCTGATACTGGGAGCAAGGTGG + Intergenic
1084843532 11:71879157-71879179 CTGTGAACCAAGGATTATGGTGG - Intronic
1084847408 11:71911323-71911345 CTCTGATACCAGGAGCAAGGTGG - Intronic
1085802292 11:79601684-79601706 CTCTGAGAATAAGAATATGGAGG - Intergenic
1085998916 11:81955197-81955219 CTCTGATACCAGGAGCAAGGTGG - Intergenic
1086766542 11:90702773-90702795 CACTGAGCCTAGAATTATGGAGG + Intergenic
1086973282 11:93106267-93106289 CTCTGATACCAGGAGCAAGGTGG + Intergenic
1087270664 11:96108254-96108276 TTCTGATACCAGGAGTTTGGTGG - Intronic
1090264421 11:125345039-125345061 TTCTGATCCTAGGCTGATGGGGG - Intronic
1091320852 11:134648687-134648709 CTCTTTTACTAGGATTGTGTAGG + Intergenic
1092650974 12:10634516-10634538 CTCTGATTTTAGAATTATGAAGG - Intronic
1096207899 12:49738735-49738757 CTCTGATACTGGGAGCAAGGTGG - Intronic
1096509059 12:52117218-52117240 CTCTGATACTGGGAGCAAGGTGG + Intergenic
1098248569 12:68545203-68545225 CTCTGATACTGGGAGCAAGGTGG - Intergenic
1098748598 12:74268702-74268724 CTCTGATACTGGGAGCAGGGTGG - Intergenic
1099028294 12:77493310-77493332 CTCAGATACTACCATTCTGGTGG + Intergenic
1100944176 12:99761204-99761226 TTTTGATATTAGGATGATGGCGG - Intronic
1104173849 12:126309855-126309877 CTCTGATCATAGGATGATGATGG - Intergenic
1106856265 13:33856662-33856684 CTCAGATACCAGGATTACTGGGG + Intronic
1107168698 13:37314359-37314381 TCCTGATGCTAGGATTCTGGTGG - Intergenic
1107262281 13:38507924-38507946 CTCTGGTATTAGGATAATGTTGG + Intergenic
1107686072 13:42899785-42899807 GTCTGATATTAGGATTAAGATGG + Intronic
1109404218 13:61876553-61876575 TTCTGGAACTAGGATGATGGTGG - Intergenic
1109802954 13:67401567-67401589 CTCTGATACTGGGAGTAGGGTGG - Intergenic
1109983418 13:69941972-69941994 CTCTGGTCCTGGGATTTTGGGGG - Intronic
1111406705 13:87816066-87816088 ATTTGATTCTAGGGTTATGGTGG - Intergenic
1115065454 14:29254503-29254525 CTCTAATCATAGGATTTTGGGGG - Intergenic
1115767771 14:36641562-36641584 ATCTGATGCTAGCATCATGGAGG - Intergenic
1118039604 14:61902618-61902640 CTCTGAAACTTGGCTTTTGGTGG + Intergenic
1118114692 14:62762029-62762051 TTCTGAAGCTAGGATTCTGGAGG - Intronic
1118281628 14:64434068-64434090 CTATGATACTATGATTATTTAGG + Intronic
1120857836 14:89227995-89228017 CTGTGATACTAGCACTTTGGGGG - Intronic
1122621556 14:103060405-103060427 CTCTGATCATAGGATTCTAGAGG + Intergenic
1123779307 15:23609625-23609647 CTCTGATAATAAGCTTCTGGAGG + Intronic
1125213913 15:37247090-37247112 CTCTGTTACTAGCACTATGCTGG + Intergenic
1129672904 15:77616944-77616966 CTCTGGTACTAGGAAGAAGGTGG - Intronic
1130864579 15:87921483-87921505 CTCTGAGACCAGGAGTAGGGAGG - Intronic
1133439416 16:5807924-5807946 CCCAGATACAAGGTTTATGGTGG - Intergenic
1136709284 16:32221999-32222021 CTCTGAAACTAAGATGTTGGTGG + Intergenic
1136758626 16:32707420-32707442 CTCTGAAACTAAGATGTTGGTGG - Intergenic
1136809482 16:33162959-33162981 CTCTGAAACTAAGATGTTGGTGG + Intergenic
1136815958 16:33273039-33273061 CTCTGAAACTAAGATGTTGGTGG + Intronic
1141419884 16:83907264-83907286 ACATGATACTAAGATTATGGAGG + Intronic
1203060780 16_KI270728v1_random:967748-967770 CTCTGAAACTAAGATGTTGGTGG - Intergenic
1143504626 17:7356821-7356843 ATCTGACACTGGGATTGTGGGGG - Exonic
1143847299 17:9782325-9782347 CTCTGAGACAAGGATTCGGGTGG + Intronic
1146076229 17:29731987-29732009 CTCTGTTACAAGAATTTTGGTGG - Intronic
1146812083 17:35911836-35911858 CTGTGATCCTTGAATTATGGAGG - Intergenic
1147810135 17:43162953-43162975 CTCTGATACCAGGAGCAAGGTGG + Intergenic
1149139392 17:53412108-53412130 CTTTGATATTAGGATGATGCTGG + Intergenic
1151274427 17:73023265-73023287 CTTTGATACATGGATTTTGGGGG - Intronic
1151604280 17:75126410-75126432 CACCGTTACTAGGATTCTGGGGG - Intronic
1153878366 18:9397106-9397128 CTCTGCTGCCAGGAGTATGGAGG - Intronic
1153936535 18:9930521-9930543 CTCTCATACTAGTTTTATGGTGG + Intronic
1163934373 19:20428865-20428887 CTCTGATACTAGGAGTAAGGTGG + Intergenic
1163943255 19:20514186-20514208 CTCTGATACTGGGAGCAGGGTGG + Intergenic
1165782804 19:38443703-38443725 CTCAGATACTAGGGTTGTAGAGG - Exonic
1167935318 19:52901594-52901616 CTTTGATACTAGGAGTAAGGTGG + Intergenic
926648365 2:15314707-15314729 CTCTCATACAAGTATTTTGGTGG - Intronic
927167914 2:20343923-20343945 CTCTGATACTGGGATGAGGGCGG - Intronic
928590264 2:32807611-32807633 ATAGGATACTATGATTATGGGGG + Intronic
929099499 2:38296855-38296877 CATTGATTCTAGGATTTTGGAGG - Intronic
930518497 2:52435162-52435184 CTCTGATACCGGGAGTAAGGTGG - Intergenic
932349892 2:71023245-71023267 CTCTGATACCAGGAGCAAGGTGG - Intergenic
932980317 2:76656444-76656466 TTTTGATACTAGGGTAATGGAGG + Intergenic
934473445 2:94576721-94576743 CTCTGATCCTGGGATCCTGGTGG - Intergenic
935721318 2:105981843-105981865 CTCTGATACCAGGAGCAAGGTGG + Intergenic
939090917 2:137779469-137779491 CTCTGAGATTAGGATTATAGAGG + Intergenic
940479512 2:154210782-154210804 TTCTGATAAGAGAATTATGGTGG + Intronic
940872147 2:158869020-158869042 CTCTGATACCAGGAGCAAGGTGG - Intergenic
941264683 2:163346548-163346570 CTTTGATTTTAGGATTTTGGTGG - Intergenic
941669497 2:168277130-168277152 CTCATATACAAGGATTATGAGGG + Intergenic
945289921 2:208116761-208116783 CTCTGATACCAGGAGCAAGGTGG - Intergenic
945563922 2:211372182-211372204 CTCTGTTACGATGATTATGGAGG + Intergenic
947049238 2:226023627-226023649 CTCGGCTACTAGGGTTTTGGAGG - Intergenic
947272316 2:228351014-228351036 CTGTAATAGTTGGATTATGGTGG - Intergenic
1169980934 20:11383192-11383214 CTTTGATATCAGGATGATGGTGG - Intergenic
1170400941 20:15982660-15982682 CTCTGATACCAGGAGTAAGGTGG + Intronic
1175513720 20:59554328-59554350 CTCTGATACCAGGAGCAAGGTGG + Intergenic
1176055596 20:63145286-63145308 CTCTGGTATCAGGATTATGCTGG + Intergenic
1178447669 21:32660431-32660453 CTCTGATACTGGGAGCAGGGTGG - Intronic
1179669230 21:42934015-42934037 CTCTGATACCAGGAGCAAGGTGG - Intergenic
1182144215 22:27987251-27987273 CTCTGGTGTTGGGATTATGGGGG - Intronic
949158069 3:850794-850816 CTCTGATACCAGGAGTAAGGTGG - Intergenic
949323472 3:2838287-2838309 TTCTAAAGCTAGGATTATGGAGG - Intronic
949764357 3:7509812-7509834 CCCTGATACTTAGATTTTGGAGG - Intronic
951035436 3:17927212-17927234 AGCTGATACTAGAATCATGGGGG + Intronic
955888681 3:63627275-63627297 CTGTGATACTAAAATTTTGGGGG + Intergenic
955898994 3:63732092-63732114 TTCTGATTTTTGGATTATGGCGG - Intergenic
956996170 3:74828585-74828607 CTCTGATACCAGGAGTAAGGTGG - Intergenic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
957406235 3:79777219-79777241 CTCTGATACTGGGAGCAGGGTGG - Intergenic
960873310 3:122272868-122272890 CTTTGAAGTTAGGATTATGGTGG + Intronic
962097546 3:132307645-132307667 CTCTGATACCAGGAGCAAGGTGG - Intergenic
962277233 3:134024873-134024895 CTCTGATACTGGGAGCAAGGTGG - Intronic
964932838 3:162047287-162047309 CTCTGATACCAGGAGTAAGGTGG + Intergenic
967088112 3:186112086-186112108 CTCTGATTCTGGGAATTTGGAGG + Intronic
968988708 4:3894313-3894335 CTCTGATACTCGGAGCAAGGTGG + Intergenic
969019688 4:4131555-4131577 CTCTGATACCAGGAGCAAGGTGG + Intergenic
969749874 4:9101876-9101898 CTCTGATACTGGGAGCAAGGTGG - Intergenic
969784630 4:9445237-9445259 CTGTGAACCAAGGATTATGGTGG - Intronic
971027471 4:22602655-22602677 CTCTGATGCCAGGAGTAAGGTGG - Intergenic
972257882 4:37378369-37378391 TTCTAATACTATGATTTTGGGGG - Intronic
972275085 4:37549670-37549692 CTCTGATACCAGGAGTAAGGTGG - Intronic
974988121 4:69054545-69054567 CTCTGATACCAGGAGTAAGGTGG - Intronic
976990167 4:91355887-91355909 CCCTGATACCAGGAGTAAGGTGG + Intronic
977972558 4:103228686-103228708 CTCTGATACTGGGAACAAGGTGG - Intergenic
979052621 4:115953736-115953758 CTCTGATACCAGGAGTGAGGTGG - Intergenic
980073171 4:128264901-128264923 CTCTGATACCAGGAGCAAGGTGG - Intergenic
980346181 4:131623002-131623024 GTATGATAATGGGATTATGGAGG + Intergenic
981365224 4:143894659-143894681 CTCTGGTACCAGGATGATGCTGG - Intronic
981798036 4:148620822-148620844 CTTTGATGTTAGGATTATGTTGG - Intergenic
983898143 4:173103483-173103505 CTCTGATACCAGGAGCAAGGTGG - Intergenic
989095869 5:37780831-37780853 CTCTGATACCAGGAGCAAGGTGG + Intergenic
991122209 5:63029489-63029511 CTCTGATGATAGTATTTTGGAGG - Intergenic
992989528 5:82270039-82270061 CTCTGATACCAGGAGTAAGATGG + Intronic
993268557 5:85762530-85762552 CTCTGGGGCTAGGATCATGGTGG + Intergenic
994798545 5:104339096-104339118 CTCTGATAATACTATGATGGTGG + Intergenic
1000202208 5:159022371-159022393 TTCTGACACTAGGCATATGGAGG + Intronic
1004485600 6:16063503-16063525 CCCAGATACCAGTATTATGGTGG - Intergenic
1004592070 6:17061420-17061442 CACTGAGACTAAGATTATAGAGG + Intergenic
1004717478 6:18231869-18231891 CTTTGATATCAGGATGATGGTGG - Intronic
1005507803 6:26485101-26485123 CTCTGAGACCAGGAATTTGGTGG - Intergenic
1006032006 6:31183208-31183230 CTCTGTTACCAGGAGTAAGGTGG + Intergenic
1008197879 6:48547356-48547378 CTATGGTATTTGGATTATGGGGG + Intergenic
1010601689 6:77835604-77835626 ATCAGATACTATGATTATGTGGG + Intronic
1013559130 6:111286942-111286964 CTCTGATACCAGGAGTAAGGTGG + Intergenic
1015172094 6:130265183-130265205 CTCTGATACCAGGAGCAAGGTGG - Intronic
1020323108 7:6954766-6954788 CTCTGATACTGGGAGCAAGGTGG + Intergenic
1021078472 7:16334286-16334308 CTCTATTACTAGGATTAGGTGGG - Intronic
1032359173 7:131239070-131239092 CTGAGATTCTATGATTATGGTGG + Intronic
1032782472 7:135175035-135175057 CTCTGATACCAGGAGGAAGGTGG - Intergenic
1032979403 7:137264642-137264664 CTCTGATACCAGGAGTAAGGTGG + Intronic
1033762040 7:144446220-144446242 CTATGATACTAAAATTATTGGGG + Intergenic
1036834405 8:12048895-12048917 CTGTGAACCAAGGATTATGGTGG + Intergenic
1036856249 8:12295459-12295481 CTGTGAACCAAGGATTATGGTGG + Intergenic
1036903551 8:12689590-12689612 CTCTGATACTGGGAGCAAGGTGG + Intergenic
1037371169 8:18180540-18180562 CTTTGATACTAGAATAATGCTGG + Intronic
1039278335 8:35955925-35955947 CTCTGATACCAGGAGCAAGGTGG - Intergenic
1041227310 8:55713283-55713305 CTCTGATACCAGGAACAAGGTGG - Intronic
1041515637 8:58696090-58696112 CTCTGATACCAGGAGCAAGGTGG - Intergenic
1042063118 8:64843007-64843029 CTCTGATATTAGGTTCATGAGGG - Intergenic
1044680496 8:94772952-94772974 CTGTAATCCTAGGATTTTGGGGG + Intronic
1047320429 8:123775277-123775299 ATATTATACTGGGATTATGGAGG + Exonic
1048332609 8:133481050-133481072 CTGTGATACTTGGATAATGTGGG + Intronic
1048983784 8:139718655-139718677 CTCTCATCCAAGGATTATGTAGG - Intergenic
1052408272 9:28090218-28090240 CTTTGATATTAGGATGATGCTGG - Intronic
1052508268 9:29382128-29382150 CTCTGATACCAGGAGCAAGGTGG - Intergenic
1053684889 9:40511781-40511803 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1053934850 9:43140064-43140086 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1054278838 9:63113175-63113197 CTCTGATCCTGGGATCCTGGTGG - Intergenic
1054297980 9:63347244-63347266 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1054395998 9:64651762-64651784 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1054430642 9:65156957-65156979 CTCTGATCCTGGGATCCTGGTGG + Intergenic
1054499738 9:65864564-65864586 CTCTGATCCTGGGATCCTGGTGG - Intergenic
1058544343 9:106044026-106044048 CTCTGCTTCTAGTAGTATGGAGG - Intergenic
1059959426 9:119550862-119550884 CTCTTATTCTCGGTTTATGGGGG - Intergenic
1059961604 9:119570320-119570342 CTCTGATGCTGGGACTAGGGTGG + Intergenic
1185909915 X:3971834-3971856 CTCTGATACTGGGAGCAGGGTGG - Intergenic
1186558554 X:10586512-10586534 CTCTGATACCAGGAGTAAGGTGG + Intronic
1190005558 X:46733589-46733611 TTATGATACTAGCATGATGGAGG + Intronic
1190314816 X:49143844-49143866 CTCTGATACCAGGAGCAAGGTGG + Intergenic
1190425888 X:50334299-50334321 CTCTGATACTAGGAGCAGGGTGG + Intronic
1190771405 X:53517689-53517711 CTCTGATACTGGGAGCAAGGTGG - Intergenic
1191917795 X:66221306-66221328 CTCTGATACTGGGAGCAAGGTGG + Intronic
1196229867 X:113209008-113209030 CTTTGATATTAGGATGATGCTGG + Intergenic
1196869582 X:120099993-120100015 CTCTGATACCAGGAGCAAGGTGG - Intergenic
1199217592 X:145278314-145278336 CTGTTACACTAGGATGATGGTGG + Intergenic
1199950087 X:152699913-152699935 CAGTGATCCTAGGATAATGGAGG - Intronic
1199959587 X:152768548-152768570 CAGTGATCCTAGGATAATGGAGG + Intronic
1200394122 X:155973266-155973288 CTCTGATACTGGGAGCAGGGTGG + Intergenic
1200948243 Y:8867063-8867085 CTCTGATACTGGGAGCAAGGTGG - Intergenic
1201259927 Y:12148964-12148986 CTCTGATACTGGGAGCAAGGTGG + Intergenic
1201373025 Y:13285939-13285961 CTCTGATACCAGGAGCAAGGTGG - Intronic