ID: 1079927759

View in Genome Browser
Species Human (GRCh38)
Location 11:26516593-26516615
Sequence GAAAATGCACTAATGCACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 0, 2: 13, 3: 98, 4: 447}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079927759 Original CRISPR GAAAATGCACTAATGCACAT AGG Intronic
900837790 1:5019257-5019279 GAGAACGGATTAATGCACATGGG + Intergenic
901767236 1:11510795-11510817 GAAAAGGAACTAATACAGATGGG - Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902939745 1:19792171-19792193 GAAAATGGACTAATACACCAAGG + Intronic
903146673 1:21377211-21377233 GAAAATGAACTAATAAAGATGGG + Intergenic
906463947 1:46059286-46059308 GAAAATGGACTAATACAAATGGG + Intronic
907721066 1:56972708-56972730 GAAAATGGACTAATACAGATAGG + Intergenic
907965374 1:59323761-59323783 TTAAATGAATTAATGCACATAGG + Intronic
908292710 1:62684534-62684556 GAAAATGTACTAAAGAATATAGG - Intronic
908427724 1:64024176-64024198 GAAAATGGACTAATACAAATGGG + Intronic
909290068 1:73871364-73871386 GAAAATGGTATAATTCACATGGG + Intergenic
909510911 1:76451170-76451192 GAGAATGGACTAATACAGATGGG - Intronic
909529563 1:76667218-76667240 GAGAATGGACTAATTCACCTGGG - Intergenic
909816632 1:80002457-80002479 TAGAATTCACTAATGAACATTGG - Intergenic
910105887 1:83630620-83630642 GAAAATTGACTAATACAGATAGG + Intergenic
910621197 1:89257087-89257109 GAAAATGGACTAATATACTTAGG - Intergenic
911483380 1:98473856-98473878 GAGAATGAACTAATACACTTGGG + Intergenic
911760456 1:101608550-101608572 GAGAATGGACTAATACACTTAGG + Intergenic
912071201 1:105811806-105811828 GAAAATGGACTAATACACCCTGG + Intergenic
913316441 1:117557880-117557902 GAAAATGAACTAATACAGAGGGG - Intergenic
914007847 1:143748864-143748886 CAGAATGGACTAATACACATGGG - Intergenic
916512347 1:165483453-165483475 GAGAATGGACTAATACACTTGGG - Intergenic
918073350 1:181150161-181150183 GAAAATGGACTAAGACAAATGGG - Intergenic
918356567 1:183710499-183710521 GAAAATGGACTAATACACCTGGG - Intronic
918429554 1:184444586-184444608 GAAAATGGACTAATACAACTGGG + Intronic
919279007 1:195462426-195462448 GAAAATGCACTAATACATTGAGG - Intergenic
919333110 1:196196580-196196602 GAGAATATACAAATGCACATAGG - Intergenic
920016645 1:202916280-202916302 GAAAATGGATTAGAGCACATTGG - Intronic
920412085 1:205770164-205770186 GGAGATGCAGAAATGCACATGGG + Exonic
920734401 1:208517718-208517740 GAAAATGAACTAATACAGATTGG - Intergenic
920891586 1:209992498-209992520 GAAAATGTAGTAATAGACATTGG + Intronic
920909936 1:210206831-210206853 GAAAATAGACTAATACACAGAGG + Intergenic
921275925 1:213520134-213520156 GAAAATGGACTAATACACAGAGG - Intergenic
921295653 1:213699419-213699441 GAAAATGTACTTATACACAACGG - Intergenic
921562630 1:216676759-216676781 GCAACTGTACAAATGCACATTGG - Intronic
921894062 1:220380548-220380570 GAAAATGGACTAATATACCTGGG + Intergenic
922569824 1:226627812-226627834 GAAAATGGACTAATGCAGGTGGG - Intergenic
922858601 1:228796101-228796123 AAAAATGCCCTAATGCAAACTGG + Intergenic
922940419 1:229459803-229459825 GAAAATGCTGCAATGAACATGGG + Intronic
923637508 1:235714813-235714835 TAAACTGCAATAATGTACATAGG + Intronic
924205043 1:241703679-241703701 GAAAATGGATTAATACACAACGG - Intronic
1062883689 10:999571-999593 GAAAATGCAGAAATCCACACTGG - Intronic
1064606434 10:17045686-17045708 GAAATTGCATTAATGGAAATTGG - Intronic
1064930886 10:20625283-20625305 GAAAATGGACTAATACAGAAAGG - Intergenic
1065073192 10:22049008-22049030 GAAAATGCAGTAATGCTCGCTGG - Intergenic
1065751232 10:28889869-28889891 GAAAATGGACTAATACACACAGG - Intergenic
1065764643 10:29016536-29016558 TAAAATGCAGAACTGCACATGGG - Intergenic
1066191993 10:33064515-33064537 GAAAATGAACTAATACACAAGGG + Intergenic
1066281473 10:33922310-33922332 GAAAATGGACTAATACAGAACGG + Intergenic
1067339236 10:45387801-45387823 GAAAATTCACTAATTCAGACTGG + Intronic
1067540369 10:47146524-47146546 GAAAATGCACTCAGCCACAATGG - Intergenic
1068262821 10:54605493-54605515 GAAAATCCACCAATGATCATAGG + Intronic
1068924899 10:62526261-62526283 GAAAATGGACTAATACAGAAGGG - Intronic
1069875289 10:71559252-71559274 AAAAATGCACAAATCCACAAGGG - Intronic
1071718324 10:88118906-88118928 GGGAATGCCCTAATGCACACTGG - Intergenic
1072883810 10:99255822-99255844 GAAAATGGACTAATGCAACTGGG - Intergenic
1073726742 10:106240773-106240795 GAAAATTAACAAATGCACATAGG - Intergenic
1074525879 10:114262831-114262853 TAAAATACAGTAGTGCACATCGG + Intronic
1074608487 10:114998055-114998077 GAAGAAACACTAATACACATAGG + Intergenic
1074940662 10:118233569-118233591 GAAAACGGACTAATACACAAGGG - Intergenic
1075220068 10:120576901-120576923 GGAAATGCCCTAACTCACATAGG - Intronic
1075825991 10:125357392-125357414 GAAAATGGACTAATACAGCTGGG - Intergenic
1076275406 10:129194524-129194546 GAAAATGGACTAATACATAGAGG - Intergenic
1076689917 10:132217910-132217932 GAAAATAGACTAATACAGATGGG + Intronic
1077180809 11:1214283-1214305 GAAAATGGACTAATACAGAACGG - Intergenic
1077425681 11:2474969-2474991 AACAATGCACAAATGCACAAAGG - Intronic
1077997364 11:7465671-7465693 GAAAATGGACTAATACAGCTGGG - Intronic
1078058468 11:8027880-8027902 GAAAATGCTCCAGTGAACATTGG + Intronic
1079109700 11:17598138-17598160 TTAAATGAAGTAATGCACATAGG - Intronic
1079927759 11:26516593-26516615 GAAAATGCACTAATGCACATAGG + Intronic
1080227735 11:29978543-29978565 GAAAATGGACTAATACAGTTGGG + Intergenic
1080824809 11:35838938-35838960 GAAAATGGACTAATACAGATGGG - Intergenic
1081577307 11:44327161-44327183 GAAAATACAGCAATGCACATGGG + Intergenic
1082972056 11:59033728-59033750 GCAATAGCACTAATGAACATAGG - Intronic
1083042885 11:59705200-59705222 GGAAATGTACAAATGTACATTGG - Intergenic
1085799878 11:79579629-79579651 GAAAATGGACTAATACACATGGG - Intergenic
1086146779 11:83560848-83560870 GAGAATGGACTAATACACAGGGG - Intronic
1087697923 11:101402266-101402288 TAAAATGCACTAAGTCAAATGGG - Intergenic
1087812864 11:102626846-102626868 GAGAATGGACTAATACACACAGG + Intergenic
1088733344 11:112703550-112703572 GAATATGGACTAATACACCTGGG + Intergenic
1088903296 11:114135013-114135035 GAAGATGCAAGAATGCATATAGG + Intronic
1088934664 11:114387607-114387629 GAAAATGGACTAAGACACCTTGG + Intergenic
1089598102 11:119594995-119595017 CAAAATGAACTTATGCATATAGG + Intergenic
1090016505 11:123090916-123090938 GCAAATGCTATACTGCACATAGG - Intronic
1090542076 11:127717747-127717769 TAAAATACACTAATGAACAATGG + Intergenic
1090924810 11:131240085-131240107 GAAAATGGACTAATAGAAATGGG + Intergenic
1090966916 11:131606809-131606831 GAAAACTCACTAAAGCACACTGG - Intronic
1091564788 12:1640160-1640182 GAAAAAGCACGTATGCCCATTGG - Intronic
1093315759 12:17647671-17647693 GAAAATGGACTAATACACTGGGG + Intergenic
1094236889 12:28178159-28178181 GAAAATGGACTAATACACTTGGG + Intronic
1094271853 12:28625908-28625930 GAAAATGAACTAATACACTCCGG + Intergenic
1094367959 12:29704083-29704105 GAAAATGTACAAATACACTTAGG + Intronic
1094660365 12:32464517-32464539 GAAAAAGGACAAATGCACATAGG + Intronic
1096339214 12:50783075-50783097 GAAAATGTATTAATGGAAATAGG + Intronic
1099734455 12:86550283-86550305 GAGAATGGACTAATACACAGAGG + Intronic
1100451903 12:94714940-94714962 AAATATGCACATATGCACATTGG + Intergenic
1100638802 12:96461462-96461484 CAAAATGCACTCATACACAGGGG - Intergenic
1102392635 12:112561901-112561923 GAGAACGGACTAATACACATTGG + Intergenic
1102432478 12:112894425-112894447 GCAGATGCTCTAATGCATATTGG + Intronic
1102528830 12:113531420-113531442 GAAAATGGACTAATACACATGGG + Intergenic
1102603136 12:114048168-114048190 AATAATGCTCTAATGAACATGGG - Intergenic
1102716536 12:114978291-114978313 GAAAATGGACTAATACACTGAGG - Intergenic
1103896931 12:124279259-124279281 GTAAATGCACTCATGTGCATTGG + Intronic
1104304832 12:127600219-127600241 GAAAATGGACTAATACAAAAAGG + Intergenic
1104498312 12:129261565-129261587 GAAAATGGACTAATACAGACTGG + Intronic
1104572098 12:129934459-129934481 GAAAATGGACTAATACAAATGGG + Intergenic
1105825782 13:24121624-24121646 GAAATTGGACAAATGCTCATAGG + Intronic
1106910353 13:34456543-34456565 GAAAATGAACTAATACAATTAGG + Intergenic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1109337322 13:61009115-61009137 GAAAATGGACTAATACATATGGG + Intergenic
1109879475 13:68451857-68451879 GAAAACAGACTAATACACATGGG + Intergenic
1109880253 13:68463954-68463976 GAGAATGAACTAATACACCTAGG + Intergenic
1110193732 13:72761654-72761676 GAAAAGCCACTGATGCACGTTGG + Exonic
1110378007 13:74815505-74815527 GAAAATGGACTAATACACCTAGG + Intergenic
1110462323 13:75758915-75758937 GAAAATGAACTAATACACACAGG - Intronic
1110802481 13:79715400-79715422 GAAAATGGACTAATACACTTTGG - Intergenic
1111314085 13:86529066-86529088 GAAAATGGACTAATACACTGTGG + Intergenic
1111801550 13:92987090-92987112 GAAAATGGACTAATAGACATAGG + Intergenic
1112750875 13:102582270-102582292 GAAAATGAACTAATACACATAGG - Intergenic
1113915436 13:113868260-113868282 GAAAATTGACTAATACACTTGGG + Intergenic
1113986783 13:114323921-114323943 GAAAATGTACAAATCCATATGGG + Exonic
1114216573 14:20661732-20661754 GAAAAAGCAGTTATGCCCATCGG + Intergenic
1114795539 14:25711441-25711463 GAGAATAGACTAATACACATAGG - Intergenic
1115190526 14:30743181-30743203 GAGAATGGACTAATACACACAGG + Intergenic
1115806990 14:37062877-37062899 GAGAATGCACTAATACACCAGGG - Intronic
1117632891 14:57711385-57711407 GAGAATGGACTGATACACATGGG + Intronic
1117958783 14:61143329-61143351 GAAAATGGACTAATACAGATGGG - Intergenic
1119157228 14:72422261-72422283 GAAAATGGACTAATACAAATGGG + Intronic
1120137060 14:80882695-80882717 GAAAATGTACTTATACACAACGG + Intronic
1120258013 14:82143431-82143453 GAAAATGGACTAATACATATAGG + Intergenic
1120692182 14:87605175-87605197 GAAGATGGACTAATACACATGGG - Intergenic
1121207348 14:92180456-92180478 GAAAATGGACTAATACAGGTGGG + Intergenic
1121267706 14:92615165-92615187 GAAAATGGACTAATACAAACAGG + Intronic
1121368297 14:93334287-93334309 GAAAATGAAGTAATACAAATTGG - Intronic
1121483664 14:94297309-94297331 GAAAATGGACTAATACACTGTGG - Intergenic
1121590819 14:95107236-95107258 AAAAATTCACTTATTCACATGGG - Intronic
1121687779 14:95851615-95851637 GAATATGCTGTAATGAACATGGG - Intergenic
1122008034 14:98721952-98721974 GAGAATGGACTAATACAGATGGG + Intergenic
1122361979 14:101172863-101172885 GAAAATGGACTAATACAGATTGG - Intergenic
1122646118 14:103195375-103195397 GAAACTGGACTAATGCTCAATGG + Intergenic
1123124447 14:105936254-105936276 GAAAATGGACTAATACACTATGG - Intergenic
1124527041 15:30465049-30465071 GAAAAAGCTCTAATGTTCATTGG - Intergenic
1124771612 15:32542634-32542656 GAAAAAGCTCTAATGTTCATTGG + Intergenic
1124786487 15:32686121-32686143 GGAAATGGAATAATGCAAATTGG - Intronic
1125128375 15:36252069-36252091 GAGAATGGACTAATGCAGAGGGG - Intergenic
1125376114 15:39031472-39031494 GAAACTGCACAAATCCACGTGGG + Intergenic
1126272922 15:46843820-46843842 GAAAATGGACTAATATATATTGG - Intergenic
1126982437 15:54259283-54259305 GAAAATGTACTAATACACTTGGG - Intronic
1127007390 15:54585523-54585545 CAAAATGGACTAATACAGATGGG + Intronic
1127224496 15:56916171-56916193 GAAAATGAACTAAAACACATGGG + Intronic
1128470895 15:67951602-67951624 GAAAATGGACTAATAGAAATGGG + Intergenic
1128718470 15:69927823-69927845 GAAAATGGACTAATCCACAAGGG - Intergenic
1129092266 15:73163856-73163878 GATAGTACAGTAATGCACATTGG + Intronic
1129585645 15:76861756-76861778 GAAAATGGACTAATACATTTAGG - Intronic
1129838457 15:78728409-78728431 GAAAAAGCATTAATGTACTTAGG + Intergenic
1130260129 15:82348162-82348184 GAAAATGCATTAATGTACTTGGG - Intronic
1130268601 15:82431271-82431293 GAAAATGCATTAATGTACTTAGG + Intronic
1130281103 15:82520846-82520868 GAAAATGCATTAATGTACTTAGG + Intergenic
1130448916 15:84031099-84031121 GAAAATGGACTAATACAGAGGGG + Intronic
1130472474 15:84237026-84237048 GAAAATGCATTAATGTACTTAGG + Intronic
1130479966 15:84351597-84351619 GAAAATGCATTAATGTACTTAGG + Intergenic
1130491804 15:84436532-84436554 GAAAATGCATTAATGTACTTAGG - Intergenic
1130503419 15:84515572-84515594 GAAAATGCATTAATGTACTTAGG - Intergenic
1130594771 15:85241663-85241685 GAAAATGCATTAATGTACTTAGG + Intergenic
1131556672 15:93405383-93405405 GAAAATGGACTAATACACCTGGG + Intergenic
1131755486 15:95556451-95556473 GAAAATGCTTAAATGCACATAGG - Intergenic
1131852553 15:96558116-96558138 GAAAATGGACTAATACAAAAAGG + Intergenic
1131926075 15:97385358-97385380 GAGAATGCACAAATACACTTGGG - Intergenic
1132230753 15:100182070-100182092 AAAAATGGCCTAATGCACAGTGG - Intronic
1132811387 16:1799752-1799774 GAGAATGGACTAATGCAGATGGG + Intronic
1134423879 16:14120023-14120045 GGAAATGTACTATTTCACATTGG - Intronic
1134601276 16:15535719-15535741 GAAAATGGACTAATACAAAATGG - Intronic
1134606180 16:15573076-15573098 GAAAATGGACTAATACAACTAGG + Intronic
1134768459 16:16783043-16783065 GAAAATGGACTAATACACCTGGG + Intergenic
1134782610 16:16912021-16912043 GAAAATGGACTAACACACAAGGG + Intergenic
1135036783 16:19085294-19085316 AAAAATGCATGTATGCACATAGG + Intergenic
1135645456 16:24157618-24157640 GAGAATGGACTAATACACATGGG + Intronic
1135645497 16:24157937-24157959 GAGAATGGACTAATACACATGGG + Intronic
1135723367 16:24835601-24835623 GCAAATGGACTAATACAGATGGG - Intergenic
1135817427 16:25648062-25648084 GAAAATGGACTAATACAAACAGG + Intergenic
1138019940 16:53469745-53469767 GAAAGTTCACTAATGAATATAGG + Intronic
1138908999 16:61373916-61373938 GAAAATGGACTAATACACCAAGG + Intergenic
1139089253 16:63624215-63624237 GAAAATGAGCTAATGCATGTTGG - Intergenic
1139134024 16:64179426-64179448 GAAAATGGACTAATACACCCTGG + Intergenic
1139299540 16:65933678-65933700 GAAAATGGACTAATACAGAAGGG + Intergenic
1140552711 16:75884818-75884840 GAGAATGGACTAATACACAGTGG - Intergenic
1141161541 16:81632549-81632571 GAAAATGCTGTCATCCACATAGG + Intronic
1141411277 16:83834801-83834823 GAAAATGGACTAATACATAAGGG + Intergenic
1143308655 17:5970136-5970158 GAGAATGGACTAATAGACATAGG + Intronic
1144538358 17:16113981-16114003 GAAAATGAACTAATACATAATGG - Intronic
1146088770 17:29855199-29855221 GAAAATGTACTATTAGACATAGG + Intronic
1146557368 17:33837672-33837694 GAGAATGAATTAAGGCACATAGG - Intronic
1146670171 17:34731892-34731914 GACAAAGCAATCATGCACATGGG - Intergenic
1147241502 17:39093665-39093687 GAAATTGCACTATTGCACTCCGG + Intronic
1149051860 17:52314425-52314447 GAATATGCAGCAATGAACATGGG - Intergenic
1149143303 17:53459252-53459274 GAAAATGAACTAATACAGATGGG + Intergenic
1149155763 17:53628687-53628709 GAAAATGCTACAATGAACATGGG + Intergenic
1149251653 17:54777239-54777261 GAAAATGAACTAATGCAGTAAGG + Intergenic
1149308828 17:55374487-55374509 GAAAATGGACTAATACAGCTGGG + Intergenic
1150537847 17:66062201-66062223 GAAAATGGACTAATACATAGTGG + Intronic
1150865672 17:68846922-68846944 GAAAAATACCTAATGCACATAGG + Intergenic
1151280545 17:73070942-73070964 GAAAATGAACTAATACACCTAGG + Intronic
1151350667 17:73530158-73530180 GAAAATGGACTAATGCAGGAGGG - Intronic
1152010070 17:77707560-77707582 GAAAACGGACTAATACACTTTGG + Intergenic
1153235793 18:2985977-2985999 GAAAATGCAGAAATGCACTTAGG - Intronic
1155918380 18:31578150-31578172 GAAAATGAACAAATGCAGGTGGG + Intergenic
1155923762 18:31631872-31631894 GAAAATACATTAAAGTACATGGG + Intronic
1156644932 18:39149507-39149529 GAGAATGGACTAATACATATGGG - Intergenic
1156850118 18:41716271-41716293 GAAAATGCCTTAATGGAAATGGG + Intergenic
1157387982 18:47275905-47275927 AAGAATGCACAAATGAACATAGG + Intergenic
1158256950 18:55562085-55562107 TAAAATACAGTAATGCTCATTGG + Intronic
1158623978 18:59056190-59056212 GAAAACGGACTAATGCAGAGGGG - Intergenic
1158883336 18:61802028-61802050 GAAACTTAACCAATGCACATTGG + Intergenic
1159077581 18:63699347-63699369 GAAAATGAACTAATACAATTAGG - Intronic
1159749572 18:72283531-72283553 GAAAATGGACTAATACAGAAAGG - Intergenic
1160290291 18:77586808-77586830 GAAAATAGACTAATACACCTGGG + Intergenic
1160439551 18:78878952-78878974 GAAAAGGCAGTAAACCACATGGG + Intergenic
1164229395 19:23274345-23274367 TAAAATGCACTAATGCTGAGAGG - Intergenic
1164443192 19:28295212-28295234 GAAAATGTACTTATACACAATGG - Intergenic
1164499128 19:28798734-28798756 GCAAATGCAATGATGCACAAAGG + Intergenic
1164577242 19:29412706-29412728 GAAAATGGACTAATACACTTGGG + Intergenic
1165883399 19:39059534-39059556 GAAAATGTACATATGCACAGTGG - Intergenic
1166263074 19:41656656-41656678 GAAAATGGACTAATACAGATAGG - Intronic
1167403645 19:49289672-49289694 GAAAATGAACTAATACAGACTGG + Exonic
1167929079 19:52849035-52849057 GAAAATGCAAAAATACACAAGGG + Intronic
925118921 2:1402477-1402499 GAAAATGGACTAATTCACTGAGG - Intronic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925475568 2:4210719-4210741 GAAAACGGACTAATACACCTGGG - Intergenic
925876566 2:8316348-8316370 GAAAATGGACTAATGCATGAAGG - Intergenic
926493284 2:13552487-13552509 GAAAATGCAAATATGCACAATGG + Intergenic
926729535 2:16025788-16025810 GAAAACGGACTAATACATATGGG - Intergenic
927786495 2:25978692-25978714 GAAAATGCAATAACACACTTCGG - Intronic
928054071 2:28033302-28033324 GAAAATGGACTAAGACACACTGG - Intronic
929273982 2:40005753-40005775 GAAAATGGACTAATACACCAGGG - Intergenic
930427681 2:51233143-51233165 GATAATGGACTAATACAGATAGG - Intergenic
930457351 2:51622299-51622321 GAAAATGGACTAATACATATAGG - Intergenic
930729583 2:54714706-54714728 AAAAATGTAATAATGCAAATAGG + Intergenic
932239372 2:70144960-70144982 GAAAATTCACTAATAGACAAAGG + Intergenic
932657472 2:73622669-73622691 GAAAATGGACTAATACACATGGG + Intergenic
932664138 2:73682936-73682958 GAAAATGGACTAATACACATGGG + Intergenic
935070484 2:99689497-99689519 GCAAGTGCACTAATAGACATGGG - Intronic
935309981 2:101773923-101773945 GAAAATGTACTTATACACAATGG - Intronic
937448453 2:121978651-121978673 GAAAATGGACTAATACACCTGGG - Intergenic
937481817 2:122269316-122269338 GAAAATGCACGAATGGGCAGAGG + Intergenic
937777943 2:125803536-125803558 GAGAATGGACTAATACAGATGGG - Intergenic
938470479 2:131555317-131555339 GTATATTCACTAATTCACATTGG + Intergenic
938590294 2:132729341-132729363 GAAACTACGCTAATGCCCATTGG - Intronic
939346929 2:140977416-140977438 GAAAATGGACTAATACATATGGG + Intronic
941057484 2:160805801-160805823 GAAAATGGACTAATACAGATAGG - Intergenic
941889309 2:170561521-170561543 AAAAATGCACAAATGTACACCGG + Intronic
942283142 2:174387916-174387938 GAAAACACACTAATACACAGTGG + Intronic
943907396 2:193517156-193517178 GCAAATGAACTAATACATATAGG - Intergenic
944386289 2:199168568-199168590 GAAAATGGACTAATACATTTGGG + Intergenic
944430972 2:199633352-199633374 GAGAAGAGACTAATGCACATAGG - Intergenic
945358039 2:208861503-208861525 GAAAATGGACTAATACACTTGGG + Intergenic
946169913 2:217888844-217888866 GAAAATGGACTAATACACCAGGG + Intronic
946530180 2:220562246-220562268 GAAAAATTACTAATGCACATGGG + Intergenic
946531380 2:220574063-220574085 GAAAATGGACTAATACAGAAGGG - Intergenic
946586543 2:221195033-221195055 GAAAGTGCAGGAATGCACAATGG + Intergenic
946729348 2:222693471-222693493 GAAAATGAACTAATACAAAATGG - Intronic
946832031 2:223736941-223736963 GAAAATGGACTAATACATAAAGG + Intergenic
948200085 2:236123485-236123507 GGAAATACACTAATTCACAAAGG + Intronic
948240721 2:236431207-236431229 GAGAATGGACTAATACACCTGGG - Intronic
1169395094 20:5221982-5222004 GAAAATGGACTAAGGCACCTGGG + Intergenic
1169498165 20:6134294-6134316 GAAAATGAACTAATACACCCTGG + Intergenic
1169760378 20:9085868-9085890 GAAAATGAACTAATTCCCATGGG - Intronic
1170348141 20:15409829-15409851 GAGAAGGCACTGATGTACATGGG + Intronic
1170721254 20:18881202-18881224 GAAAACTCACTAATTTACATGGG - Intergenic
1171092085 20:22294785-22294807 GAAAATGGACTAATACAGAAGGG + Intergenic
1171148790 20:22808972-22808994 GAAAGTGCACTAATGTTCAAGGG - Intergenic
1171754025 20:29084100-29084122 GAAAATGGATTAATGCAAAAAGG - Intergenic
1173252690 20:41373030-41373052 GAAAATGGACTAATATACAGGGG + Intergenic
1173377751 20:42504618-42504640 TAAAATGTAATAATGCAAATAGG - Intronic
1173964715 20:47103425-47103447 GAAAATGGACTAATACACAATGG - Intronic
1174285879 20:49472995-49473017 CAAAATGGACTAATACAGATAGG + Intronic
1176890219 21:14307491-14307513 GATAATGCTGTAATGAACATGGG - Intergenic
1177090671 21:16763551-16763573 GAAAATACACGTATGCACAATGG + Intergenic
1177925701 21:27211808-27211830 GAAAATGGACTAATACACAAGGG + Intergenic
1177928061 21:27243649-27243671 AAAAATGCACATATGAACATGGG - Intergenic
1178099425 21:29252140-29252162 GAAAATGGACTAATATACTTGGG - Intronic
1178477561 21:32950653-32950675 GAAAATGCACAAATGAAGAAGGG - Intergenic
1178623151 21:34193916-34193938 GAAAATGGACTAATACAGACAGG + Intergenic
1178683681 21:34694748-34694770 GAGAATGGACTAATACACCTTGG + Intronic
1178740306 21:35193893-35193915 GAAAATGGACTAATACAGATGGG - Intronic
1179561008 21:42216255-42216277 GAAAATGGACTAATACAGACAGG + Intronic
1180028518 21:45184311-45184333 AAAAATGCACTGAAGCAAATAGG - Intronic
1180686332 22:17669960-17669982 GAAAATGGACTAATACACATGGG + Intronic
1181385142 22:22539449-22539471 GAAAAAGAGCTAATGCATATTGG - Intergenic
1182201628 22:28577507-28577529 GAAAATCCACAAATAAACATTGG - Intronic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182364749 22:29770980-29771002 GAAAATGGACTAATACACAAGGG + Intergenic
1184007131 22:41718639-41718661 TAAAATGCACTAAGACACCTAGG - Intronic
1184386262 22:44176722-44176744 GAGAATGGATTAATACACATAGG - Intronic
1184386408 22:44178178-44178200 GGAAATGGACTAATACACATAGG + Intronic
949187190 3:1206334-1206356 GAAAATACACTGATGCATGTGGG - Intronic
950934493 3:16824790-16824812 GAAAATTCCATAAGGCACATAGG - Intronic
951104121 3:18723468-18723490 GAAAATGGATTAAGACACATGGG - Intergenic
951953178 3:28224443-28224465 GAAAATGGACTAATACAAGTGGG - Intergenic
952059674 3:29492268-29492290 GAAAATACTCTAATATACATCGG - Intronic
954209374 3:49086051-49086073 GAAAATACTCTAATGCTCTTGGG + Intronic
954316655 3:49805158-49805180 AACAGTGCACTAATGCACACGGG - Intergenic
955146733 3:56327109-56327131 GAAAATGGACTAATACACATTGG - Intronic
956268345 3:67423393-67423415 GAGAATGGACTAATACACCTAGG + Intronic
958638364 3:96775140-96775162 GAAAATGGACTAATACAGGTGGG - Intergenic
958799487 3:98738602-98738624 GAGAATGAACTAATACAGATGGG + Intronic
959160386 3:102716885-102716907 GAAAATCCCCTAAAGCACAAGGG + Intergenic
959794501 3:110408245-110408267 GACAATGCAGTCATGAACATGGG + Intergenic
960116197 3:113895302-113895324 GGAAATACACTAATGCACGGTGG - Intronic
960359077 3:116688943-116688965 GAGAATGGACTAATACACTTAGG - Intronic
960462360 3:117952001-117952023 GAGAATGAACTAATACAGATGGG + Intergenic
960535436 3:118809852-118809874 GAAAATGGACTAATACAGACAGG - Intergenic
960581278 3:119281252-119281274 GGAAATGCAATAATGGACTTGGG + Intergenic
961231511 3:125316208-125316230 GAAAATGTACATATGCACAATGG - Intronic
961342983 3:126242144-126242166 GAAAATGGACTAATAAATATTGG + Intergenic
962162007 3:133010603-133010625 GAAAATGAACTAATACACACAGG - Intergenic
962322500 3:134403449-134403471 GAAAATGAACTAATACACCATGG + Intergenic
962965440 3:140349301-140349323 GAGAATGGACTAATGCACTATGG + Intronic
963267148 3:143250760-143250782 GGAAATGGACTAATACACAAGGG + Intergenic
963347988 3:144118855-144118877 GAAAATGGTCTAATACAAATAGG + Intergenic
963916521 3:150863964-150863986 GAAAATGGACTAATACACCCAGG - Intergenic
964600182 3:158491935-158491957 GAAAATGGACTAATACACACAGG - Intronic
964654715 3:159053151-159053173 GAAAACGAACTAATACACCTGGG + Intronic
965074110 3:163954122-163954144 GAAAATGTACTTATGCACCATGG + Intergenic
966627708 3:182036634-182036656 GAAAATGGACTAATACAGAAAGG - Intergenic
966824557 3:183952825-183952847 AAAAATGGACTAATACACAACGG + Intronic
969107240 4:4816911-4816933 GAGAATGGACTAATACACACAGG + Intergenic
970279933 4:14443884-14443906 GAAAATGGACTAATACATCTGGG + Intergenic
970503909 4:16707394-16707416 GAAAATGGCCAAATGGACATGGG + Intronic
970518061 4:16853676-16853698 GAAAATGCTGCAATGAACATGGG - Intronic
970799703 4:19958120-19958142 GAAAATGGACTAATACACCCAGG - Intergenic
971030074 4:22626514-22626536 GAATATGCATTATTGCACTTAGG + Intergenic
971070128 4:23081462-23081484 GAAAATGGACTAATACAACTGGG + Intergenic
971084359 4:23254095-23254117 AAAAATGCACAAAGGGACATAGG - Intergenic
971459422 4:26878648-26878670 GAAAATGAACTAATACAGATGGG - Intronic
971753469 4:30679434-30679456 GAAAGTGGACTAATTCAGATAGG + Intergenic
972220451 4:36949149-36949171 GAGAATGGACTAATACAGATGGG - Intergenic
972664391 4:41150023-41150045 GAAAATGGACTAATACACTGGGG + Intronic
972792560 4:42387112-42387134 GAAAATGTACTAATACACCATGG - Intergenic
973166824 4:47088299-47088321 ACAAATGCAATAATGCACATAGG + Intronic
973334971 4:48946982-48947004 GAAAATGGACTAATACAGTTGGG - Intergenic
974382581 4:61160492-61160514 CAAAATACACTAAGACACATGGG - Intergenic
974511294 4:62845358-62845380 GAAAATGGACTAATACAGATTGG - Intergenic
975253810 4:72211984-72212006 GAAAATGGACCAATACACCTGGG - Intergenic
975919787 4:79371406-79371428 GAAAATGAACTAATACAGTTGGG - Intergenic
977099737 4:92795503-92795525 GAAAATGGACTAATGGAGAGAGG + Intronic
977326262 4:95578670-95578692 TCAAATGCACAGATGCACATAGG - Intergenic
978107552 4:104921978-104922000 GAAAAAGCACTAAGCAACATAGG + Intergenic
978396026 4:108281074-108281096 GAAAATGGACTAATACACATTGG - Intergenic
981310464 4:143293293-143293315 GAAAATGCACTTCTACACAAGGG + Intergenic
981422564 4:144567825-144567847 GAAAACAGACTAATGCACCTAGG + Intergenic
981694791 4:147549418-147549440 GAAAACGGACTAATACATATGGG + Intergenic
981695398 4:147554025-147554047 GAAAATGGACTAATACAATTGGG + Intergenic
981821105 4:148888481-148888503 GAAAATGCACTCATTATCATAGG + Intergenic
982829390 4:160042175-160042197 GAAAATGAACTAATACACCAGGG - Intergenic
982922060 4:161288123-161288145 TAAAAGGAACTAATGCAAATAGG - Intergenic
983772537 4:171569721-171569743 GAAAATGGACTAATACACTTGGG - Intergenic
984718937 4:182952478-182952500 GAGAATGCACTAATACAACTAGG + Intergenic
986085053 5:4436794-4436816 GAAAATGGACTAATACAAAAGGG - Intergenic
987261907 5:16212888-16212910 GAAAATGGACTAATACAGAGTGG - Intergenic
987461299 5:18214458-18214480 GAGAATGAACTAATACACAGCGG - Intergenic
987600455 5:20061967-20061989 GAACATTCAGTAATGCACTTAGG - Intronic
987692753 5:21288963-21288985 GAAAATTCACTAATTGACATAGG - Intergenic
987909261 5:24121298-24121320 GAAAATGGACGAATACACAGAGG - Intronic
988159500 5:27501946-27501968 GAAAATGGACTAATACAGTTGGG - Intergenic
988200268 5:28059638-28059660 GAAAATTAACTAATAAACATAGG + Intergenic
988289417 5:29266648-29266670 GAGAATGGACTAATACAGATAGG - Intergenic
988386344 5:30570278-30570300 GAAAATTCATTAAAGCAAATAGG - Intergenic
988924720 5:35978320-35978342 GAAAATGGACTAATACAGAGTGG - Intronic
989005039 5:36800792-36800814 GCAAATGGACTAACACACATGGG + Intergenic
989111589 5:37912028-37912050 GAAAATATACTTATGCACAATGG + Intergenic
989177385 5:38541843-38541865 GAAAATGAACAAATACAGATGGG + Intronic
989651453 5:43695648-43695670 GAAAATGGACTAATACACCTTGG - Intronic
990229420 5:53695566-53695588 AAAAATGGACTAATACAAATAGG + Intergenic
990336652 5:54779227-54779249 GAAAATGAACTAATACAGAGGGG + Intergenic
990504756 5:56433270-56433292 AAAAATGCACTAATGGCCTTGGG - Intergenic
991195297 5:63924979-63925001 GAAAATGGACTAATACATGTGGG + Intergenic
991259590 5:64652638-64652660 GAAAATGGACTAATACAGAGGGG - Intergenic
991747543 5:69760755-69760777 GAAAATTCACTAATTGACATAGG + Intergenic
991750186 5:69794571-69794593 GAAAATTCACTAATTGACATAGG - Intergenic
991799122 5:70340612-70340634 GAAAATTCACTAATTGACATAGG + Intergenic
991801758 5:70374371-70374393 GAAAATTCACTAATTGACATAGG - Intergenic
991826894 5:70635974-70635996 GAAAATTCACTAATTGACATAGG + Intergenic
991829475 5:70669422-70669444 GAAAATTCACTAATTGACATAGG - Intergenic
991891479 5:71340038-71340060 GAAAATTCACTAATTGACATAGG + Intergenic
992075906 5:73192486-73192508 GAGAATGGACTAATACACTTGGG + Intergenic
993569844 5:89523884-89523906 GAAAATGGACTAATACAAAGGGG - Intergenic
993661952 5:90648457-90648479 GAAAATACACTAATGTATTTAGG - Intronic
993704513 5:91154592-91154614 GAGAATGGACTAATACAGATAGG - Intronic
994186655 5:96822703-96822725 GAAAAGGAACTAATACAAATGGG - Intronic
994578472 5:101610540-101610562 GAGAATGGACTAATACACGTGGG - Intergenic
994866364 5:105276867-105276889 GAAAATGGACTAATACATACTGG + Intergenic
995244338 5:109919533-109919555 GAAAATGGACTAATACACCCTGG + Intergenic
995318165 5:110800139-110800161 GAAAATGGACTAATACAGAGAGG - Intergenic
995745127 5:115394616-115394638 CAAAATGCAATAATGTATATGGG - Intergenic
996055711 5:118980027-118980049 GAAAATGAAGAAATGAACATTGG - Intronic
996253012 5:121360882-121360904 GAAAATACACTAAAGCAGGTTGG - Intergenic
996267581 5:121561162-121561184 AAAAATGCATTAATGAGCATAGG + Intergenic
996872121 5:128203250-128203272 GAAAACGGACTAATGCACAGGGG + Intergenic
997065471 5:130554382-130554404 GAGAATGGACTAATGCACCAAGG - Intergenic
997269532 5:132525246-132525268 GAGAATGAACTAATACACATGGG + Intergenic
999336269 5:150719785-150719807 AAAAATGCATTAATGTTCATTGG + Intronic
999571779 5:152926845-152926867 GAGAATGAACTAATGCAGAGAGG + Intergenic
1000512854 5:162205108-162205130 AAAAATGCTATAATGAACATGGG - Intergenic
1000803679 5:165760747-165760769 GAAAATACGCTAATGGATATTGG + Intergenic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1003180320 6:3785272-3785294 GAGAATGGACTAATACACTTGGG + Intergenic
1003818327 6:9866507-9866529 GAAAATGGACTAATACAAATGGG + Intronic
1003897825 6:10624203-10624225 GAAAACGGACTAATACACCTTGG - Intronic
1005115245 6:22328877-22328899 GAAATTGCCCCAATGCAAATGGG - Intergenic
1006421682 6:33938426-33938448 GAAAATGGACTAATCCAGCTGGG - Intergenic
1008025775 6:46634392-46634414 GAAAACGGACTAATACAAATAGG + Intronic
1008048866 6:46879644-46879666 AAAAATGGACTAATACATATCGG + Intronic
1009221534 6:60990093-60990115 AAAAACACACTAAAGCACATAGG - Intergenic
1009332720 6:62443921-62443943 TCAAATGCAATAATGCCCATAGG - Intergenic
1009529481 6:64793479-64793501 AAAAATGCTCAAATGCATATTGG + Intronic
1011207875 6:84920511-84920533 GAAAAAGCACTAAAGCACCAGGG + Intergenic
1012042548 6:94227347-94227369 GTAAATGTACTAAAGCAAATTGG - Intergenic
1012188771 6:96255010-96255032 GAAAATGGACTAATACAATTAGG - Intergenic
1012638837 6:101582597-101582619 GAGAATGGACTAATACAGATGGG + Intronic
1012879281 6:104766117-104766139 AGTAATGCACAAATGCACATCGG + Intronic
1013378806 6:109545684-109545706 GAAAATGGACTAATACACCAAGG + Intronic
1013486776 6:110604247-110604269 AAAAATGGACTAATGCAGAAAGG + Intergenic
1014147530 6:118015237-118015259 GAAGATGGACTAATACACTTAGG + Intronic
1014918532 6:127183814-127183836 GAGAATGCACTAATACAGGTGGG - Intronic
1015983007 6:138857808-138857830 GAGAATGGAATAATACACATAGG - Intronic
1017524353 6:155229694-155229716 GAAAATGAATTAATACACCTGGG - Intronic
1017763474 6:157588974-157588996 GAAAATAGACTAATACAGATGGG - Intronic
1018182389 6:161235510-161235532 GAGAATGGACTAATCCAGATGGG - Intronic
1018184447 6:161253927-161253949 GACAATGCAGTAATGAACACTGG + Intronic
1019091382 6:169537745-169537767 GAAGAGGCAGTAATGGACATGGG + Intronic
1020345234 7:7154989-7155011 GAAAATGGACTAATACACATGGG + Intergenic
1020389875 7:7646653-7646675 GAAAATGAACTAATACAGATGGG + Intronic
1020706516 7:11550718-11550740 GAAAATGAACTAATTCAGATAGG + Intronic
1021665592 7:22975069-22975091 GAAAATGGACTAATACACTCAGG + Intronic
1021792487 7:24219386-24219408 GTAAATGCACTAATGGCCAGTGG - Intergenic
1022982627 7:35618682-35618704 GAAAATGGACTAATACAGAGTGG + Intergenic
1023658834 7:42452945-42452967 GAAAATGGAATAAGCCACATGGG + Intergenic
1025225701 7:57160215-57160237 GTAAAAGCCCTAAAGCACATTGG - Intergenic
1025267576 7:57476973-57476995 GTAAAAGCCCTAAAGCACATTGG + Intergenic
1025813852 7:64891839-64891861 AAAAATGGAGAAATGCACATGGG - Intronic
1025818866 7:64945096-64945118 AAAAATGGAGAAATGCACATGGG + Intergenic
1026295107 7:69044775-69044797 GAAAATGGACTAATACACCTGGG - Intergenic
1026454873 7:70562221-70562243 CAAAATGGACAAATACACATGGG + Intronic
1026619412 7:71937061-71937083 GAAAATGGACTAATACAATTAGG + Intronic
1026703831 7:72672311-72672333 GAAAATGGACTAATACCCAAGGG + Intronic
1026975509 7:74495402-74495424 GCAAAGGCACTAAGGCACAAGGG - Intronic
1027732575 7:81894547-81894569 GAAAATGGAATAATAGACATTGG - Intergenic
1028884288 7:95913687-95913709 GAGAAAGGACTAATACACATGGG + Intronic
1028930185 7:96404349-96404371 TATAATGGACTAATACACATGGG + Intergenic
1029441988 7:100591932-100591954 GAAAATGGACTAATACAGGTGGG - Intronic
1030535647 7:110763092-110763114 GAAAATGAAGAAATCCACATTGG + Intronic
1030787016 7:113674828-113674850 GAAAATGGACTAATACACAGGGG - Intergenic
1030956211 7:115855847-115855869 GAAAATGGACTAATACACCCAGG - Intergenic
1031480049 7:122267371-122267393 GAAAATGAACTAATACAGATGGG + Intergenic
1031623248 7:123961699-123961721 GAAAATGGACTAATACACATAGG - Intronic
1031978227 7:128107232-128107254 GAATATGCACAAAAGCATATGGG + Intergenic
1033182303 7:139192692-139192714 GAAAGTGCACTAAGCCACAGAGG - Intergenic
1034083610 7:148303124-148303146 GAAAATGGACTAATACACCATGG + Intronic
1034683745 7:152951486-152951508 GAGAATGGACTAATACACATGGG + Intergenic
1036087375 8:5626895-5626917 GAAAATGGACTAATACAGAGGGG + Intergenic
1037107854 8:15131490-15131512 GAAAATGGACTAATACACTAAGG + Intronic
1037968554 8:23153920-23153942 AATAATGCTCCAATGCACATGGG - Intronic
1038153985 8:24970055-24970077 GAAAATGTAATAATACACAATGG - Intergenic
1038522461 8:28244911-28244933 GAAAATAGACTAATACAGATGGG - Intergenic
1038549794 8:28457375-28457397 GAAAATGGACAAATACACAAGGG - Intronic
1039072530 8:33659850-33659872 GAAAATGAACTAATACATGTGGG + Intergenic
1041300481 8:56406421-56406443 CAAAATGAACTAAGGCAAATGGG + Intergenic
1041684659 8:60632306-60632328 GAAACTGCCCAAATGCCCATTGG - Intergenic
1041739444 8:61142429-61142451 GAAAATGGACTAATACAATTGGG + Intronic
1041779596 8:61563305-61563327 GAAAAGGCACCAAAGTACATAGG + Intronic
1042923351 8:73941298-73941320 GAAAATGGACTAATACAGAGAGG + Intronic
1043641209 8:82452442-82452464 GCAAGTGGACTAATGCTCATGGG + Intergenic
1044256298 8:90066835-90066857 GAAAATGAATTAATGCAATTAGG + Intronic
1044781578 8:95749070-95749092 CCAAATGAAATAATGCACATGGG - Intergenic
1045718555 8:105078111-105078133 ATAAATGCACTAATCCAAATGGG + Intronic
1045911787 8:107418605-107418627 GAAAATCCAGTAATGAACAATGG + Intronic
1046150482 8:110217792-110217814 GAAAATGTACCTATGCACAATGG + Intergenic
1046165760 8:110432614-110432636 GAAAATGGACTAATACAGACTGG + Intergenic
1046776383 8:118168204-118168226 GAAAATAGACTAATACACAATGG + Intergenic
1046889291 8:119403498-119403520 GAACATGCATTTATGCATATTGG + Intergenic
1047306516 8:123657315-123657337 GAAAATGCTAGAATGCACAGGGG - Intergenic
1047860282 8:128958299-128958321 GAATATGCATTTATGCACTTGGG - Intergenic
1048128583 8:131665563-131665585 GAGAATGGACTAATACAGATTGG - Intergenic
1048129767 8:131682228-131682250 GATAATGCTGTAATGAACATGGG + Intergenic
1048478698 8:134768413-134768435 GAAAATGGACTAATACAGAGAGG - Intergenic
1048698412 8:137055642-137055664 GAAAATGCACTGATGCCCATGGG + Intergenic
1048998956 8:139812695-139812717 GAAAATACACTAATTTATATAGG - Intronic
1049453592 8:142675815-142675837 GAAAACCCACTGATGCACATGGG - Intronic
1049489461 8:142887200-142887222 GACAATGAACTAATACAAATTGG - Intronic
1049946802 9:604946-604968 GAAAATGGACTAATGCAATTGGG + Intronic
1050243067 9:3658683-3658705 GAAAATGCACTATAGCACAGAGG + Intergenic
1051019095 9:12518660-12518682 AATAATGCAATAATGCACATGGG - Intergenic
1051890655 9:21939278-21939300 GAAAACGGACTAATGCACATGGG + Intronic
1051988312 9:23118754-23118776 GAAAATGGACTAATACAAGTAGG - Intergenic
1052178605 9:25497234-25497256 GAAAATCTAAGAATGCACATAGG + Intergenic
1052688523 9:31783952-31783974 GAAAATGGACTAATACACTGAGG - Intergenic
1052701492 9:31942505-31942527 GAAAATGGACTAATACACTTGGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052997827 9:34560666-34560688 GCAAATGCTCTTATGCACACAGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053519619 9:38764536-38764558 GTAAATGGACTAATACACAGTGG + Intergenic
1055330921 9:75183291-75183313 GAAAACGGACTAATGCATCTTGG - Intergenic
1055366933 9:75554804-75554826 GAAAATGAACTAATACATATGGG - Intergenic
1056527108 9:87453947-87453969 GAAAATGTACTAATACAGAGGGG - Intergenic
1056562476 9:87743745-87743767 GAATATGCATTTTTGCACATAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056962305 9:91136364-91136386 GAAAATGGACTAATACAAGTGGG - Intergenic
1057626307 9:96680341-96680363 GAAAATATACTAAGGCACCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058736203 9:107896424-107896446 GAAAATGAACTAATACCCCTGGG + Intergenic
1059881414 9:118694222-118694244 GTAAATGCATCAAGGCACATTGG + Intergenic
1059941646 9:119365892-119365914 GAAAAGGCTCTATTGCAGATGGG + Intronic
1060178186 9:121513229-121513251 GAAAATGGACTAATGCTAGTAGG - Intergenic
1060620443 9:125060835-125060857 GAAAATGGACTAATACAGCTAGG + Intronic
1061341439 9:129984970-129984992 GAAAATGGACTAATACAATTAGG + Intronic
1185961919 X:4553747-4553769 GAGAATGCTCAAATGCAGATTGG + Intergenic
1186051767 X:5604177-5604199 GAGAATGGACTAATACAGATGGG - Intergenic
1186345299 X:8685793-8685815 GAAAATGAACTTACCCACATTGG + Intronic
1186449164 X:9657651-9657673 GAAAATCCACTAATCCACACAGG - Intronic
1187133431 X:16524971-16524993 GAAAATGGACTAATACACTTAGG - Intergenic
1187144294 X:16623619-16623641 GAAAATGTACTTATACACAATGG - Intronic
1187285787 X:17902444-17902466 GGAAAAGCCCTAATGTACATTGG + Intergenic
1187550131 X:20294053-20294075 GTAATTACACTAATGCACAGAGG - Intergenic
1187846731 X:23546327-23546349 GAAAATACACAAATGCAAACAGG + Intergenic
1188462141 X:30440802-30440824 CAAAAGGCACTAATGCTCAGTGG + Intergenic
1188473251 X:30563396-30563418 GAGAATGGACTAATACACATGGG + Intronic
1188893781 X:35642389-35642411 GAAAAAGCAGTAATCTACATTGG + Intergenic
1189080693 X:37968766-37968788 GAACAATCACTAATGCACAGGGG - Intronic
1189821903 X:44876723-44876745 GAAAATCCAATAATATACATAGG - Intronic
1190469578 X:50764801-50764823 GAAAATGGACTAATACAAGTTGG - Intronic
1190857537 X:54311578-54311600 GAAAAAGCAATAAAGCAGATAGG + Intronic
1191189015 X:57645978-57646000 GAAAATGTACATATACACATTGG + Intergenic
1192676420 X:73201842-73201864 GAAAATGGACTAATACACTATGG - Intergenic
1192708142 X:73549499-73549521 GAAAATGCCATACTGCACAAAGG + Intergenic
1193003965 X:76595632-76595654 GAAAACGGACTAATACAGATGGG - Intergenic
1193891237 X:87048389-87048411 GAAAATGTACTTATACACAATGG - Intergenic
1194335456 X:92640853-92640875 GAAAATGGACTAATAAAAATGGG + Intergenic
1194352547 X:92839080-92839102 GAAAATGGATTAATACAGATGGG - Intergenic
1194754001 X:97715563-97715585 GAACATGCACTTATGCACTTTGG + Intergenic
1195083588 X:101393142-101393164 GAAAATGCACCTATACACAGTGG + Intronic
1196301471 X:114053654-114053676 GAAAATGGACTAATACACTCAGG - Intergenic
1196480625 X:116142652-116142674 GAAAATGGACTAATACACCCAGG + Intergenic
1196855969 X:119984624-119984646 GCAAATGCTATACTGCACATAGG - Intergenic
1196970052 X:121098915-121098937 GATAATGGACTAATACAGATGGG - Intergenic
1197568374 X:128117028-128117050 GAAAATGAACTAATACACAAAGG + Intergenic
1198083593 X:133262714-133262736 GAAAATGGACTAATACAATTGGG - Intergenic
1198252513 X:134894117-134894139 CAAAATGTACTTATGCACATAGG + Intronic
1198626292 X:138579281-138579303 AAAAATGGACTAATACAGATGGG + Intergenic
1198830109 X:140741439-140741461 CAAATTGCAGAAATGCACATAGG + Intergenic
1199032594 X:143017646-143017668 GAGAATGAACTAATACAGATAGG + Intergenic
1199219549 X:145301573-145301595 GAAAATGGACTAATGCAGTCAGG + Intergenic
1199435700 X:147810200-147810222 GAGAATGGACTAATACAAATGGG + Intergenic
1200643928 Y:5757887-5757909 GAAAATGGACTAATAAAAATGGG + Intergenic
1200660857 Y:5955819-5955841 GAAAATGGATTAATACAGATGGG - Intergenic
1200759953 Y:7028495-7028517 GAAAATCCACTAATCCACACAGG - Intronic
1200912813 Y:8546127-8546149 GACAATGTTCTAATCCACATGGG + Intergenic
1201703452 Y:16909405-16909427 GATAATGAAATAATGCACAGAGG - Intergenic
1201704478 Y:16921111-16921133 GAAAATGGACTAATGCAGGAAGG - Intergenic