ID: 1079933258

View in Genome Browser
Species Human (GRCh38)
Location 11:26590806-26590828
Sequence CTGCAAATGGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 540
Summary {0: 1, 1: 1, 2: 9, 3: 134, 4: 395}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1079933250_1079933258 14 Left 1079933250 11:26590769-26590791 CCTGCTGGATCCGGAGGGGTGGA 0: 17
1: 53
2: 127
3: 140
4: 211
Right 1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG 0: 1
1: 1
2: 9
3: 134
4: 395
1079933248_1079933258 15 Left 1079933248 11:26590768-26590790 CCCTGCTGGATCCGGAGGGGTGG 0: 17
1: 68
2: 120
3: 148
4: 241
Right 1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG 0: 1
1: 1
2: 9
3: 134
4: 395
1079933252_1079933258 4 Left 1079933252 11:26590779-26590801 CCGGAGGGGTGGAAGTCAGTGGC 0: 20
1: 67
2: 87
3: 104
4: 238
Right 1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG 0: 1
1: 1
2: 9
3: 134
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1079933258 Original CRISPR CTGCAAATGGCAGTGGTGGA CGG Intronic
900195411 1:1373295-1373317 GTACCACTGGCAGTGGTGGATGG - Intergenic
901029004 1:6295346-6295368 CTCCCACTGGCAGTGGAGGAGGG - Intronic
901232782 1:7650522-7650544 CTGGAAAAGGCGGGGGTGGAGGG - Intronic
902731528 1:18373098-18373120 CTGAAAATGACAATGGAGGAGGG - Intronic
903071302 1:20728087-20728109 CTGCAAAGGGCAGGGGGGGAAGG + Intronic
903266708 1:22162262-22162284 CTGCTGATGGGAGTGGTGAAGGG + Intergenic
904263996 1:29307365-29307387 CTGCTCAAGGCAGTGGAGGATGG - Intronic
905658060 1:39698871-39698893 CTTCCAGTGGCAGTGGTGGCAGG - Intronic
906098002 1:43237035-43237057 CTGCAGGTGGCAGGGGTGGAGGG + Intronic
906588541 1:47001918-47001940 ATGCAGAAGGCAGAGGTGGAGGG - Intergenic
907358346 1:53894578-53894600 CTTGAAATAGCAGTGGTAGAGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
910538095 1:88323047-88323069 CTGCTATGGGCAGTGGTGGTGGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911051692 1:93676878-93676900 CTGCCAAAGGCAGTGGTGCTAGG - Intronic
911282490 1:95948155-95948177 ATGGAAATGTCAGTTGTGGAAGG - Intergenic
913478354 1:119260710-119260732 TTCCAGATGGCAGTGATGGATGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919684024 1:200465030-200465052 CAGCACATGGCAGTTGTGCAGGG - Intergenic
919845633 1:201640421-201640443 CAGCAAGTGGGAGTGGGGGATGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
921193412 1:212729829-212729851 CTGCAAAGGGCAGTGATGTGTGG + Intronic
921741926 1:218695119-218695141 CTGCAATTGGCAGGGGTGATGGG + Intergenic
922567499 1:226610569-226610591 CTTCACTTGGCAGTGCTGGAAGG - Intergenic
922820236 1:228479556-228479578 CTGTAAATGACAGTGGAGGAGGG - Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923022233 1:230174180-230174202 CTGCCAATGGCAGTGGGTGTTGG - Intronic
924929380 1:248714166-248714188 CTGCATATGGCAAAGGGGGAAGG - Intergenic
1063093388 10:2887760-2887782 CTGCTAATGGCACTGGAGGCCGG + Intergenic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067295184 10:44971575-44971597 CTGCACATGGCCCTGGTGGGGGG - Intronic
1068055303 10:52005611-52005633 CTACCAATGGCAGGGGTGGGTGG - Intronic
1068086875 10:52384383-52384405 CTGCAAATGGCAGAAAAGGATGG + Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069501046 10:68953568-68953590 GTTAACATGGCAGTGGTGGAGGG - Intergenic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071228999 10:83563752-83563774 CTGCAAATGAAAGTGGCTGAGGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071327418 10:84530674-84530696 TGGCAAATGGCAGTTGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1071751252 10:88478642-88478664 CTGGAAAGGGCAGTTGAGGATGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073077604 10:100834524-100834546 CTGCAGATGGAAGTGGGGGGTGG + Intergenic
1073546939 10:104357488-104357510 CTGCAAAGGGCAGCGGGGGGTGG - Intronic
1074164610 10:110864046-110864068 CTGCAAAGTGCAGTGGTGGCCGG + Intergenic
1074684565 10:115948982-115949004 CTGCATTTGGCAGTGGGGGTTGG - Exonic
1074857750 10:117485916-117485938 CTGCAAGTGGCAGAGGTAAAGGG + Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075758502 10:124836415-124836437 AATCAAATGGCAGTGGTGTAAGG - Exonic
1076014830 10:127019172-127019194 GGGCAAATGGCAGGGTTGGATGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076898164 10:133324521-133324543 CTGCAATTGGCTGGGGTGGGCGG + Intronic
1076898173 10:133324554-133324576 CTGCAATTGGCTGGGGTGGGCGG + Intronic
1077221887 11:1421595-1421617 CTGCACCTGGCACTGGTGGGCGG + Intronic
1077441007 11:2569199-2569221 CTGGAGATGGCAGGGGTGTAAGG - Intronic
1078459537 11:11503437-11503459 CTGGAAATTGCAGTGGAGGTGGG - Intronic
1078490903 11:11767520-11767542 ATGAAGATGGCAGTGCTGGAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080105354 11:28506080-28506102 CTCCAAAAGGTAGTGGGGGAAGG - Intergenic
1080735107 11:35006489-35006511 ATTCCAATGGCAGTGGTGGTGGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1081243428 11:40734555-40734577 ATTGAAATGGCATTGGTGGAGGG - Intronic
1081419878 11:42863282-42863304 CTTCAAATGCCAGTGCAGGAAGG - Intergenic
1081749654 11:45500838-45500860 TTGTAAATGTCAGTGATGGAAGG - Intergenic
1082044057 11:47710606-47710628 TTGCAAAGGGCTGTGGTGGTGGG - Intronic
1083352027 11:62036592-62036614 CTGGAAAGGGTAGTGGGGGATGG - Intergenic
1083840139 11:65299561-65299583 CTGCAGAAGGCAGAGCTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085101077 11:73800591-73800613 CTGCAAGTGGAAGAGGAGGATGG - Intronic
1085294119 11:75421120-75421142 CTGATAATGGCAGTGGAGGAGGG - Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086123070 11:83320588-83320610 CTGGGAAGGGCAGTGGTGGTTGG - Intergenic
1087429078 11:98028366-98028388 CTCCAAAGGGCAGAGATGGATGG + Intergenic
1087430696 11:98050188-98050210 ATGGAAATGGAAGTGGTGGAGGG + Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088396505 11:109375665-109375687 GTGTAAATGGCAGGGGTGGCAGG + Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1090600649 11:128366818-128366840 CTGGAAATGGCAGTGAAGAAAGG + Intergenic
1090799549 11:130161711-130161733 ATGAAAATGGCAGAGGGGGAAGG - Intronic
1091104917 11:132909520-132909542 GTGCAGATGGCAGCGGTAGAAGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093184697 12:16006527-16006549 CTCCAGATGGCAGGGCTGGAGGG - Intronic
1093800984 12:23373148-23373170 CTGAAAATGGCAGTTAGGGAAGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095686574 12:45042691-45042713 GTTCACCTGGCAGTGGTGGACGG + Intronic
1095946468 12:47756597-47756619 CTGTAAATGGCAGTTGGGCAAGG + Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096370414 12:51064476-51064498 CTGCAACTGGCAGTCGGGGAGGG + Exonic
1096774628 12:53956387-53956409 TTGCAACTGGCAGAGCTGGAGGG + Exonic
1097201245 12:57280650-57280672 CTTCAAAAGACAGTGGGGGAGGG - Intronic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098544216 12:71693631-71693653 CTGTGAATAGCAGTAGTGGAAGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099203832 12:79705595-79705617 TTGAAAATGGCAGTGGCGGCTGG - Intergenic
1100325222 12:93533817-93533839 CTGCAAAGGGGGATGGTGGATGG + Intergenic
1101000596 12:100353815-100353837 CTGCAGATGGGAGTGGGAGAGGG - Intergenic
1101104968 12:101431614-101431636 CTGCAAATGGCAGGGCTTCACGG - Intergenic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103946047 12:124527076-124527098 CTGTTTATGGCAGTCGTGGAAGG + Intronic
1103946199 12:124528075-124528097 CTGTTTATGGCAGTCGTGGAAGG - Intronic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104979108 12:132565279-132565301 CTGGGAATGGCGGGGGTGGAGGG - Intronic
1105418752 13:20234632-20234654 CTTCCCATGGCAGAGGTGGAGGG + Intergenic
1105442697 13:20428760-20428782 CTGCAGATGGCAGGGGTGGCAGG + Intronic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107621137 13:42231879-42231901 CTGCAAATGGCTTTGGATGAGGG + Intronic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109567993 13:64143572-64143594 CTGCAAAGGGTAGTGGAGGGTGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1109934618 13:69264974-69264996 CTACAAAAGGCGGTGGTGGGTGG + Intergenic
1109960815 13:69627465-69627487 TTGCAAAAGGCAAGGGTGGATGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110700864 13:78546690-78546712 GTTCAAGTGACAGTGGTGGAAGG + Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113605975 13:111606426-111606448 CACCAAATGGCAGTGCTGGGGGG + Intronic
1113799506 13:113079038-113079060 CTGTGAATGGCAGTGGCGGGTGG - Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114847644 14:26343208-26343230 CTGCCTCTGGCAGTGGTGGCTGG - Intergenic
1115459383 14:33642813-33642835 CTCCAAATGGCCGGGATGGATGG + Intronic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116991168 14:51278231-51278253 CAGGAAATGGCGGTGGTGGTGGG + Intergenic
1117015350 14:51512180-51512202 ATGCAGCTGGGAGTGGTGGATGG + Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117620125 14:57577028-57577050 CTGGAAGAGGCAGTGGAGGATGG - Intronic
1118852078 14:69591847-69591869 CTGAAACTGGCATTGTTGGATGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119573081 14:75693561-75693583 CTGTAACTGGCAGTGATGGCAGG - Intronic
1119614680 14:76091315-76091337 CTGAACATGGCAGTGGTACAAGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120359407 14:83478584-83478606 TTCAAAATGACAGTGGTGGAGGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120762596 14:88298954-88298976 ATACAAAAGGCAGTGATGGAGGG - Intronic
1121795090 14:96728077-96728099 CTGCACATGGCAGCCCTGGAGGG - Intergenic
1121904607 14:97728239-97728261 ATGCAAGTAGCAATGGTGGATGG + Intergenic
1122125136 14:99574806-99574828 CTGCAAAAGAGACTGGTGGATGG + Intronic
1122330239 14:100907023-100907045 CTGCAAAATGGAGAGGTGGAAGG + Intergenic
1122796730 14:104209839-104209861 CTGCATACGGCAGGGGTGGGGGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1125840524 15:42797005-42797027 CTCCAAATGTCAGAGGTAGAGGG + Intronic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126540536 15:49817513-49817535 CTGGACATGGCAATGGAGGAAGG + Intergenic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1128261586 15:66236623-66236645 GTGGAAATGGCTGTGCTGGAGGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128582855 15:68820983-68821005 CAGCCAATGGCAGTGGCGGCGGG + Intronic
1128912427 15:71528203-71528225 CTGACAATGGCAGAGATGGAGGG - Intronic
1129052635 15:72795467-72795489 CTGTTAATGGTAGTGGTGGTGGG - Intergenic
1129105873 15:73306909-73306931 CTGCAATTGGGAGAGGTTGATGG - Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130257355 15:82331964-82331986 CTGCTAATCCCAGTGGTGGGGGG + Intergenic
1130381932 15:83379042-83379064 CTGCACCTGGGAGTGGTGGGGGG + Intergenic
1130597590 15:85258025-85258047 CTGCTAATCCCAGTGGTGGGGGG - Intergenic
1130997134 15:88910182-88910204 CTGACAATGGCAGTGGTGCTGGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131547967 15:93331830-93331852 CTGCACTTGGCTGTGGGGGAGGG + Intergenic
1131551023 15:93357180-93357202 GTGCAATTGGCAGTGATGGCTGG + Intergenic
1131562183 15:93454474-93454496 CTGCACATGGCAGTGAAGAAGGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132294864 15:100727483-100727505 CTGCAACAGGCAGGGCTGGAGGG - Intergenic
1132943017 16:2517670-2517692 CTACATATGTCAGAGGTGGAAGG - Intronic
1133970543 16:10564689-10564711 CTGAGAATGGTGGTGGTGGATGG - Intronic
1134625737 16:15721242-15721264 CTGAGAATGGCAGTCGAGGATGG - Intronic
1134837310 16:17372038-17372060 TTTCAAATGGCTGTGGGGGAGGG + Intronic
1136495418 16:30640394-30640416 CTGCAAATGATGGTGGAGGAGGG + Intergenic
1136938754 16:34500463-34500485 CTGCAAAAAGCAGCGGTGGTGGG + Intergenic
1136961065 16:34848093-34848115 CTGCAAAAAGCAGCGGTGGTGGG - Intergenic
1138154793 16:54693204-54693226 TTGCAAATTGCAGTGGTGGAGGG - Intergenic
1139334184 16:66219485-66219507 GTGCAGATGGCAGTGGATGATGG - Intergenic
1140041810 16:71413125-71413147 ATGCAGAAGGCAGTGGAGGAGGG + Intergenic
1140546996 16:75820327-75820349 CTGCAGATGGGCATGGTGGAAGG + Intergenic
1140861261 16:79020236-79020258 CTGCAAGGCGCAGTGCTGGATGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141879672 16:86849471-86849493 CTGCAAGAGGCAGTGGAGGTGGG - Intergenic
1142175721 16:88644023-88644045 CTGCACATGGGGGTGGTGGGGGG + Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142808418 17:2383894-2383916 CTGAAAATGGCAGTTCTGGTCGG - Intergenic
1143484502 17:7246123-7246145 CTCCAAAGTGCAGTGCTGGAAGG + Exonic
1143772021 17:9174984-9175006 CTTCAAATGGCAGTGATCCAAGG - Intronic
1143914443 17:10278658-10278680 CTGGAAATGGAGTTGGTGGACGG + Intergenic
1146622988 17:34414630-34414652 CTGAGAATGGCAGTGAGGGAGGG - Intergenic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149563137 17:57623692-57623714 CTGCTAATGGAAGTGGTGGCTGG + Intronic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152167128 17:78717076-78717098 CAGCACGTGGCAGTGGGGGAGGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153674085 18:7440158-7440180 CTGCCTCTGGCAGCGGTGGAAGG - Intergenic
1154281294 18:13005473-13005495 CTGCAAATGTCAGGGATGGGAGG + Intronic
1155524814 18:26705253-26705275 CTGTAAAGGGCAGTTGTTGATGG + Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156100021 18:33581991-33582013 CTGCAGAAGGCTGTGGGGGAGGG - Intronic
1156393211 18:36672519-36672541 GTTCAAATGGCAGTGGTGTAGGG + Intronic
1156908420 18:42381924-42381946 TTACAAATAGCAGTGGAGGAAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157422990 18:47561585-47561607 CTGCAAATGGCTTTAGGGGAGGG - Intergenic
1157689405 18:49668820-49668842 GTGCAAGTGGCAGGGGTGGGTGG + Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158692394 18:59672247-59672269 GTGCAGATGACAGTGGTAGATGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1162063159 19:8109134-8109156 CTGCTAATGGCGGTGGTGGGGGG - Intronic
1162346128 19:10119172-10119194 CTGCAAAAGGCAGCGTAGGAAGG + Intronic
1163145095 19:15374425-15374447 CTGCAGAGGGCTGTGGTGGGCGG - Intronic
1163156008 19:15440287-15440309 CTGGACATGGCGGTGGTGGGTGG - Intronic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164509503 19:28885847-28885869 AAGCAAATGGCAGTGGAGAAGGG - Intergenic
1165159088 19:33805421-33805443 GTGCAAGTGGCAGTGGGGCAGGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168210106 19:54884063-54884085 CTGCAAGTGGCAGGGGTGGGTGG + Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
927462841 2:23313841-23313863 CTGCTTTTGGCAGGGGTGGAAGG - Intergenic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929266049 2:39920269-39920291 GTGATAGTGGCAGTGGTGGATGG + Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929695741 2:44113754-44113776 TTGAATATGGCAGTGGTGGAAGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931906064 2:66845369-66845391 CTGCCAATGAGTGTGGTGGAAGG + Intergenic
931920346 2:67008552-67008574 CTGCACAAGGCAGAGGTGGCGGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936292462 2:111236764-111236786 CTGCAAATGGCTGTGGGGGGTGG + Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937305171 2:120866590-120866612 CTGCTAATGGGGGTGGGGGATGG - Intronic
937374979 2:121329953-121329975 CTGCACATGGCGGTGGGGAAGGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937666648 2:124495562-124495584 CTGCTAATGGCCATGGTGCATGG - Intronic
938035702 2:128033142-128033164 TGGCAAATGGCAGAGGTGGTGGG + Intergenic
939067121 2:137496944-137496966 CAGCAAATTGCAGAAGTGGAAGG + Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
940714212 2:157200937-157200959 CTTCACATGGCAGAGGTAGAAGG + Intergenic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942830304 2:180232054-180232076 TGGCGAATGGCAGTGGTGGATGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
946759829 2:222982657-222982679 TCGCAAATGGGAGTGGGGGAAGG - Intergenic
947610918 2:231524709-231524731 CAGAAACTGGCAGTGGTGGCAGG + Exonic
947839228 2:233197085-233197107 CTGAAGCAGGCAGTGGTGGATGG + Intronic
948316674 2:237032448-237032470 CTCCACATGGCATTGGTGCATGG - Intergenic
948826655 2:240576364-240576386 CTTCAAGTGGCAGTGCTGGCTGG + Intronic
1168754928 20:309896-309918 CTGCAAGTGGCAGGGCTGGCGGG + Intergenic
1168976911 20:1973667-1973689 CTGCCAGTGGTAGTGGTGGATGG - Intergenic
1171355681 20:24543829-24543851 CTGCAGATGGCAGTGCTGGTGGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172240234 20:33408261-33408283 CTGCAAAAGGCACTGGTGGAGGG + Exonic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173224306 20:41152993-41153015 CTGCAGAGGGCACTGGAGGAAGG - Intronic
1174546698 20:51331182-51331204 CTGAAGATGGCAGTGCTGGGAGG - Intergenic
1174846091 20:53944603-53944625 ATGAAAATGGCAGTGGTGGCCGG - Exonic
1175283490 20:57820984-57821006 TTGCAGAGGGCAGGGGTGGAAGG + Intergenic
1175681894 20:60995175-60995197 CTACAAATGGCAGAGTTTGAGGG - Intergenic
1176062744 20:63179371-63179393 CTGCAGATGGCGGCGGGGGAGGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177320495 21:19513712-19513734 CTATAAATGGCAGGGGTGGATGG - Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177448913 21:21239278-21239300 CTGAAGATGGCTGTGGTGGGAGG - Intronic
1177833770 21:26169483-26169505 CTGGAAAGGGCAGTGGCGGATGG - Intronic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177934271 21:27322877-27322899 CTGAAAATAGCAGTTGTGAAGGG + Intergenic
1178613733 21:34111452-34111474 CTTCAAATAGAAGTGGGGGAGGG - Intronic
1178826807 21:36024218-36024240 TTGGGAAAGGCAGTGGTGGAGGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179943969 21:44658214-44658236 CTGCAGAGGGCAGTGGTGCAGGG - Exonic
1182685781 22:32121048-32121070 CTGCCAGTGGCAGGGGTGGAGGG - Intergenic
1183307292 22:37089522-37089544 CTGGAAAAGGGAGTGGTTGATGG - Intronic
1183809657 22:40244086-40244108 CTGCAAGTGGAAGGAGTGGATGG - Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950111879 3:10423886-10423908 GTGCAAAGGGCAGTGGTGGTGGG + Intronic
950186336 3:10947938-10947960 GAGCAAAGGGCACTGGTGGAAGG + Intergenic
950539852 3:13605321-13605343 ATGCAGATGGAGGTGGTGGATGG - Intronic
950600630 3:14032199-14032221 CTACAGATGGCAAAGGTGGAAGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951909315 3:27732176-27732198 CTGGGATTGGCAGTGGGGGAGGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
953718866 3:45338179-45338201 CTGCATTTGGCAGAGCTGGATGG - Intergenic
954321094 3:49832577-49832599 CTGCATGTGGGAGTGGTGGGGGG - Intronic
954365963 3:50146339-50146361 CTCCAAATGTCAGTGGTAGAGGG + Intergenic
954918470 3:54168733-54168755 ATGCAAATGGGAGAGATGGAAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955625260 3:60911579-60911601 CTGGAAATGGCAGTGCTTGGTGG - Intronic
956025928 3:64983213-64983235 CAACAACTGGCAGTGCTGGAGGG - Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958043330 3:88252213-88252235 TTGCAAATATCAGTGTTGGAGGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
959456651 3:106571239-106571261 CAGAAAATGGCAGGGGAGGAGGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960244659 3:115386909-115386931 TTGCAAATAGCAGTAGTGGTGGG - Intergenic
960255172 3:115504002-115504024 CAGAAAATGGGGGTGGTGGATGG - Intergenic
961713456 3:128844070-128844092 CTTCAAGTGGCAGTAGTGCAGGG + Intergenic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963762242 3:149295481-149295503 CTGCAGATGGCAGTGCTAAAAGG + Intergenic
964611692 3:158622206-158622228 CTGCAGATGGCAAAGGGGGAAGG + Intergenic
966834508 3:184038694-184038716 CTGCAAATGTCACCTGTGGAGGG - Intronic
966843302 3:184106412-184106434 CTGCAAATGTCACCTGTGGAGGG - Intronic
967090364 3:186129841-186129863 CTGCATGTGGAAGTGGGGGATGG - Intronic
967409310 3:189151564-189151586 CTGCAAAGGGCTTTGGTGTAAGG - Intronic
968294286 3:197561887-197561909 CTGCAGATGGCAAAGGGGGAAGG - Intronic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969727217 4:8927675-8927697 CTGCAGATGGCAAAGGGGGAAGG - Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
972678964 4:41287404-41287426 CTGCAAAGGGCGGTGGGGGGTGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
975977267 4:80113558-80113580 CTGAAAAAGGCAGTAGTGTAAGG - Intronic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978110921 4:104963479-104963501 CTGGAAATGGCAGCAGTGGATGG + Intergenic
978372228 4:108040340-108040362 CTACAAATTGGTGTGGTGGAAGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979016878 4:115445975-115445997 CTGCATGTGGCAGTGTTAGAGGG + Intergenic
979452829 4:120892829-120892851 CTACTAGTGGCAGTGGTGGGTGG + Intronic
979531364 4:121772274-121772296 CTGTATATGGCAGGGATGGAGGG - Intergenic
979708300 4:123747600-123747622 CTGCATATGGTGGTGCTGGAAGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980144805 4:128969156-128969178 ATGCATATGGAAGTGGGGGAGGG - Intronic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981006337 4:139879227-139879249 TTGAAAATGGTAGTGGTGGCCGG + Intronic
981021130 4:140030174-140030196 CTGAAAATGGGAGGGGAGGAGGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984190406 4:176598832-176598854 CTGAAAATAGCAGTGATGGGAGG + Intergenic
984286087 4:177730220-177730242 CTGCAAATGGCATTGGATAAAGG + Intronic
984759041 4:183348160-183348182 CTGCAGATTTCTGTGGTGGATGG + Intergenic
984929616 4:184835169-184835191 GTGCAAATGGAAGTGGAGGATGG - Intergenic
985916491 5:2922805-2922827 CTGCAATAAGCAGTGCTGGAGGG - Intergenic
986174691 5:5341725-5341747 CTGCAGTGGGCAGTGGGGGAAGG + Intergenic
986332176 5:6725570-6725592 CAGCAAATGGCAGTGTAAGATGG - Intronic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988662926 5:33293308-33293330 CTGCTGATGGTGGTGGTGGAGGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990476323 5:56164616-56164638 CTGCACATGCTAGTGTTGGAAGG - Intronic
991262962 5:64686553-64686575 CTGCAGATGGCAGAGCTGAAAGG - Intergenic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991951407 5:71949926-71949948 CTGCACCAGGCAGTGATGGAGGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993464678 5:88230560-88230582 CTTCAAATGGGAATGGTTGAAGG - Intronic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994163521 5:96583875-96583897 CAGCAAGTGGTAGTGGTAGAGGG + Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
997530655 5:134579372-134579394 CTGGAAATGGCAGTTGTGACTGG - Exonic
997951556 5:138246528-138246550 CTGGAAAGGGCAGTGTTGCAGGG - Intergenic
998962540 5:147504031-147504053 CTGCAAATGGAAGAGGCAGAAGG - Intronic
999141365 5:149364567-149364589 CTGCAGATGGCTGCGGTGGAGGG - Intronic
1000341362 5:160279588-160279610 CTGCTGAGGGCAGTGGGGGAAGG + Intronic
1000459745 5:161499772-161499794 ATGCATAAGGCAGTGGTGGCAGG + Intronic
1000821679 5:165992389-165992411 TTGCAAATGGCAGTGCTTTATGG - Intergenic
1001709298 5:173764916-173764938 CTGCTTTTGGCAGTGATGGATGG - Intergenic
1003183941 6:3814199-3814221 CTGGTAATGGCAGTGGTGGGTGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004597040 6:17109811-17109833 CTGCAAGTGACAGGAGTGGACGG - Intronic
1005282338 6:24287294-24287316 GAGCAAATGGCAGGGGAGGAGGG - Intronic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006118738 6:31791406-31791428 CTGCAAGTGGCGGTGTTGCATGG + Intronic
1006453194 6:34117289-34117311 CTGAAAATGGCAGGGCCGGAGGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010108761 6:72199585-72199607 CTGGAGAGGGCAGAGGTGGAGGG + Intronic
1011004501 6:82628946-82628968 ATGCAAAGGGCAGTGTTGGGAGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1011634284 6:89355570-89355592 ATGCAAATGGCGGTGGAGAAAGG - Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014221843 6:118805829-118805851 CTGCAATTGGCACTGCTGGTTGG - Intergenic
1015371200 6:132455562-132455584 CTTAAAATGTAAGTGGTGGAAGG - Exonic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017511017 6:155114495-155114517 CTCCAAATGGCTGTGGGGGTGGG - Intronic
1018171160 6:161144154-161144176 CAGCAAGTGGAAGTGGTGCATGG - Intronic
1019254959 7:43750-43772 CAGCAAATGGCAGACGTGGTAGG + Intergenic
1019982498 7:4631779-4631801 CTGGAGATGGCAGTGCAGGATGG - Intergenic
1020605537 7:10332317-10332339 CTGCAAAGGAGAGTGGTGGCTGG + Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021541107 7:21759601-21759623 ATGCAAATGTAAGTGATGGATGG + Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021946625 7:25734025-25734047 CTGCAAATGAGAGTGGTGGTTGG - Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022198010 7:28088176-28088198 CTGCAAGAGACAGTGGTGCAGGG + Intronic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023113238 7:36835283-36835305 CTGCAAATGGCATATTTGGAGGG - Intergenic
1023668745 7:42554207-42554229 ATGCAAATGGGGGTGGAGGAAGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024460717 7:49656774-49656796 CTGCAAATGTCAATTCTGGAAGG - Intergenic
1024517119 7:50268489-50268511 CAGCAGATGGCAGTGGTTGCTGG - Intergenic
1025306993 7:57869190-57869212 CTGCAAAAAGCAGCGGTGGCGGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1026543916 7:71305260-71305282 CTGCAAATGGGAGTACTGGCGGG - Intronic
1027941824 7:84691828-84691850 CTGAGAATGACAGTGGTAGATGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029361119 7:100089214-100089236 CTGGAGATGGCAGTGGGGGACGG - Intronic
1029618656 7:101676304-101676326 CTGCGGATGTCAGGGGTGGAGGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030372421 7:108715319-108715341 ACACAAATGGCTGTGGTGGAAGG + Intergenic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030564663 7:111138387-111138409 CAGGAAATGCCAGTGCTGGAGGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031108346 7:117573697-117573719 ATTGAAATGGCAGTGGAGGATGG + Intronic
1031228765 7:119076834-119076856 CTGAAAATGGCAGAGGGGCAAGG - Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031408107 7:121409667-121409689 CTGCCAATAGAGGTGGTGGAGGG - Intergenic
1032417512 7:131748028-131748050 CTGCATATGTCAGAGGAGGAAGG + Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034598457 7:152223007-152223029 CTGCAAATGGCAGTGCTAGCAGG + Intronic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035664994 8:1374202-1374224 TTGCAGAAGGCTGTGGTGGAGGG + Intergenic
1035726512 8:1827642-1827664 CAGGAAATGGCAATGATGGAAGG - Intronic
1036157375 8:6355126-6355148 CTGCACATGGCAAGGGTTGAAGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037601136 8:20395186-20395208 CTGCTCATTGCACTGGTGGATGG + Intergenic
1037609212 8:20462277-20462299 CTGCACAGGTCCGTGGTGGAGGG + Intergenic
1037753700 8:21698299-21698321 TTGCAGATGGCACTGGGGGAAGG + Intronic
1038156218 8:24992785-24992807 CTGCAAATCACATTAGTGGATGG + Intergenic
1038785694 8:30613264-30613286 CTGGCAATGGCAGCTGTGGAAGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042842757 8:73140724-73140746 CTGCAAATGTCAATGGGGTATGG - Intergenic
1044640736 8:94378684-94378706 CTGCAAATTGCATGTGTGGAAGG - Intronic
1044818381 8:96136568-96136590 CTGGATATGGCAGGGGTGGGTGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046836514 8:118807698-118807720 CTGCACATGGTAGTGATGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1049161977 8:141103586-141103608 CTGCAAATGGCTGGCCTGGAGGG - Intergenic
1050112052 9:2227368-2227390 CTGCAAGTGGCAATAGTGGAAGG + Intergenic
1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055938714 9:81628162-81628184 CTGCAAATGGCGGTGGGAGGAGG + Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1060895422 9:127213868-127213890 ATGCAGATGGCAGTGCTGGTGGG + Intronic
1062341770 9:136096641-136096663 TTGGAAGTGGCAGTGGTGGGGGG - Intergenic
1186720255 X:12296523-12296545 CTGGAAATGGGAGTGGGGGTTGG + Intronic
1186725960 X:12359088-12359110 CTGCAAATGTCATTGCTGGTAGG + Intronic
1188073401 X:25745708-25745730 CAGCAAATGACAGTTGTGGCTGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189316377 X:40059638-40059660 CTGGAAATGGGAGTGTTTGAAGG + Intronic
1189942899 X:46144933-46144955 CTGGAAATGGTAGTGAGGGATGG + Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192429638 X:71103367-71103389 ATGCAAAGGGCACTGGGGGAAGG - Exonic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193783911 X:85735539-85735561 CTGGCAATGGCAGTGGTTGTGGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195766606 X:108302996-108303018 CTGCAAATTGGGGGGGTGGAGGG - Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196420244 X:115513755-115513777 CTGCTATTGTCACTGGTGGAGGG - Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196772719 X:119310858-119310880 CTGCAGATGGCATAGGGGGAAGG - Intergenic
1197545332 X:127816606-127816628 CGGGAAATGGCAGTAGTGGACGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199052217 X:143249393-143249415 TTGAAAATGGCAGAGCTGGAGGG + Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1200628045 Y:5546202-5546224 CTGCAATAGAAAGTGGTGGAGGG + Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic